ID: 1016952585

View in Genome Browser
Species Human (GRCh38)
Location 6:149594530-149594552
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 7, 3: 12, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016952580_1016952585 10 Left 1016952580 6:149594497-149594519 CCACAGGCTGCCGTGGCCGCATC 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952577_1016952585 24 Left 1016952577 6:149594483-149594505 CCAGCACACCAAGACCACAGGCT 0: 1
1: 0
2: 6
3: 24
4: 196
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952584_1016952585 -6 Left 1016952584 6:149594513-149594535 CCGCATCGTGGGTGTGTCTAAGA 0: 1
1: 0
2: 2
3: 6
4: 57
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952583_1016952585 0 Left 1016952583 6:149594507-149594529 CCGTGGCCGCATCGTGGGTGTGT 0: 1
1: 2
2: 2
3: 7
4: 84
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952575_1016952585 30 Left 1016952575 6:149594477-149594499 CCGAGGCCAGCACACCAAGACCA No data
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140
1016952579_1016952585 16 Left 1016952579 6:149594491-149594513 CCAAGACCACAGGCTGCCGTGGC 0: 1
1: 0
2: 4
3: 21
4: 203
Right 1016952585 6:149594530-149594552 CTAAGAAGAAGTAAGTCTGTAGG 0: 1
1: 0
2: 7
3: 12
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016952585 Original CRISPR CTAAGAAGAAGTAAGTCTGT AGG Intergenic