ID: 1016958981

View in Genome Browser
Species Human (GRCh38)
Location 6:149653547-149653569
Sequence GAGAACAAGGAAAAGAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016958974_1016958981 -2 Left 1016958974 6:149653526-149653548 CCCCCTCTCTTTTCACCAGGTGA No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958966_1016958981 22 Left 1016958966 6:149653502-149653524 CCATAGAAATCTCCCTCCACCCC No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958967_1016958981 10 Left 1016958967 6:149653514-149653536 CCCTCCACCCCTCCCCCTCTCTT No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958976_1016958981 -4 Left 1016958976 6:149653528-149653550 CCCTCTCTTTTCACCAGGTGAGA No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958971_1016958981 2 Left 1016958971 6:149653522-149653544 CCCTCCCCCTCTCTTTTCACCAG No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958970_1016958981 3 Left 1016958970 6:149653521-149653543 CCCCTCCCCCTCTCTTTTCACCA No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958969_1016958981 6 Left 1016958969 6:149653518-149653540 CCACCCCTCCCCCTCTCTTTTCA No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958968_1016958981 9 Left 1016958968 6:149653515-149653537 CCTCCACCCCTCCCCCTCTCTTT No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958972_1016958981 1 Left 1016958972 6:149653523-149653545 CCTCCCCCTCTCTTTTCACCAGG No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958977_1016958981 -5 Left 1016958977 6:149653529-149653551 CCTCTCTTTTCACCAGGTGAGAA No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data
1016958975_1016958981 -3 Left 1016958975 6:149653527-149653549 CCCCTCTCTTTTCACCAGGTGAG No data
Right 1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016958981 Original CRISPR GAGAACAAGGAAAAGAAGGC TGG Intergenic
No off target data available for this crispr