ID: 1016965223

View in Genome Browser
Species Human (GRCh38)
Location 6:149712521-149712543
Sequence TTCTTTTTGAATAGAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1134
Summary {0: 1, 1: 0, 2: 24, 3: 147, 4: 962}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016965218_1016965223 16 Left 1016965218 6:149712482-149712504 CCACTGCGCCCAGCCATATTTTA 0: 4
1: 40
2: 389
3: 2645
4: 12401
Right 1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG 0: 1
1: 0
2: 24
3: 147
4: 962
1016965219_1016965223 8 Left 1016965219 6:149712490-149712512 CCCAGCCATATTTTATCTTCTAT 0: 1
1: 0
2: 7
3: 85
4: 790
Right 1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG 0: 1
1: 0
2: 24
3: 147
4: 962
1016965220_1016965223 7 Left 1016965220 6:149712491-149712513 CCAGCCATATTTTATCTTCTATT 0: 1
1: 0
2: 4
3: 78
4: 1030
Right 1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG 0: 1
1: 0
2: 24
3: 147
4: 962
1016965221_1016965223 3 Left 1016965221 6:149712495-149712517 CCATATTTTATCTTCTATTCTCT 0: 1
1: 1
2: 6
3: 114
4: 1275
Right 1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG 0: 1
1: 0
2: 24
3: 147
4: 962

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016965223 Original CRISPR TTCTTTTTGAATAGAGATGA GGG Intronic
901120933 1:6893105-6893127 TGCATTTTTAGTAGAGATGAGGG - Intronic
901375388 1:8834718-8834740 TTTATTTTTAGTAGAGATGAGGG + Intergenic
901837129 1:11931481-11931503 TGTTTTTTTAATAGAGATGGGGG + Intergenic
902049569 1:13552089-13552111 TTTTTTTTCCCTAGAGATGAAGG - Intergenic
902366702 1:15979952-15979974 TTTATTTTTAGTAGAGATGAGGG - Intergenic
902631691 1:17708437-17708459 TTCATTTTGTATAGAGACAACGG - Intergenic
903122766 1:21227028-21227050 TTTTTTTTTAGTAGAGATGGAGG + Intronic
903270224 1:22183566-22183588 TTTTTTTTTTGTAGAGATGAGGG + Intergenic
903618195 1:24677777-24677799 TTCTTCTTCAATGGAAATGACGG + Intergenic
903635004 1:24807121-24807143 TTCTTTTTTTTTAGAGATGGGGG - Intronic
904025248 1:27498802-27498824 CTTTTTTTAAATAGAGATGGGGG + Intergenic
904072394 1:27811507-27811529 TTGTTTTTTAATAGAGATGAGGG + Intronic
904156622 1:28488618-28488640 TTTTTTGAAAATAGAGATGAGGG - Intronic
904559093 1:31384913-31384935 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
904694159 1:32318386-32318408 TTATTTTTTTGTAGAGATGAGGG - Intronic
904742498 1:32689111-32689133 GTATTTTTTAGTAGAGATGAGGG + Intronic
904748110 1:32723829-32723851 TTTTTTTTTAATGGAGATGGGGG - Intergenic
904814650 1:33186631-33186653 TTGTTTTTTAGTAGAGATGGGGG - Intergenic
905130565 1:35753262-35753284 TTTTTTTTTGGTAGAGATGAGGG + Intronic
905160959 1:36033468-36033490 TTTTATTTAAGTAGAGATGAGGG - Intronic
905169924 1:36103755-36103777 TGCATTTTAAATAGAGATGAGGG + Intronic
905373738 1:37503476-37503498 TTTTGTTTTTATAGAGATGAGGG - Intronic
905421557 1:37849416-37849438 TTTTTTTTTAATTGAGGTGAAGG - Intronic
905422513 1:37858002-37858024 TTTTTTTTTATTAGAGATGGGGG - Intronic
905443358 1:38008467-38008489 TTTTTTTTTAATAGAGATCGGGG - Intergenic
905962504 1:42055968-42055990 TTTTTTTTTTATAGAGATGGGGG - Intergenic
906690075 1:47786713-47786735 TTGTTTTTTTTTAGAGATGAGGG + Intronic
906740307 1:48175462-48175484 TTATTTTAGAATAGACATAAAGG - Intergenic
906868586 1:49450706-49450728 TTCTTTTAGGAGAAAGATGATGG + Intronic
907359989 1:53906563-53906585 TTCCTTTTGAACCCAGATGATGG + Intronic
907904234 1:58769700-58769722 TTGTTATTGTATAGAGATCAGGG + Intergenic
908162346 1:61422732-61422754 TTTTTTTTAAATAGAGACGGGGG - Intronic
908231136 1:62106295-62106317 TTTTTTTTAAGTAGAGATGGGGG - Intronic
908290296 1:62659028-62659050 TTCTTTTAGAATAGATCTGCTGG - Intronic
908459956 1:64339651-64339673 TTTATTTTCAGTAGAGATGAGGG + Intergenic
908902393 1:68970416-68970438 TTCTTTTTGTAAAGAGATCTTGG + Intergenic
909746160 1:79099795-79099817 TTCTTTTGGAATGGAGAAAATGG + Intergenic
909752630 1:79181980-79182002 TTCTTTTTGAATAAACAGTATGG + Intergenic
909892444 1:81024505-81024527 TTCTTTTTGAATTGATGAGAAGG + Intergenic
910432289 1:87170837-87170859 TTTTCTTTGAATAGAAAAGAAGG + Intergenic
911251525 1:95581823-95581845 TTCTTATTGACGAGTGATGAAGG - Intergenic
911607502 1:99925079-99925101 TTCTTTTTTTGTAGAGATGGGGG + Intergenic
911607525 1:99925222-99925244 TTCTTTTTTTGTAGAGATGGGGG + Intergenic
912322317 1:108725845-108725867 GTCTTTGTGAAGAGTGATGATGG + Exonic
912994984 1:114523788-114523810 TTTTTTTTTTTTAGAGATGAGGG + Intergenic
913251397 1:116914576-116914598 TTATTTTTTAGTAGAGATGGGGG - Intronic
914780955 1:150784601-150784623 TGCTTTTGGAAAAGCGATGAGGG - Intergenic
914872020 1:151482898-151482920 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
915181388 1:154064064-154064086 TTATTTTTTAATAGAGGTGGTGG + Intronic
915419977 1:155772578-155772600 TTTTTTTTTTGTAGAGATGAGGG - Intronic
915850495 1:159316656-159316678 AGCTTTCTGAATGGAGATGATGG - Intergenic
915924983 1:160010394-160010416 TTTTATTTGACTAGAGATGGAGG - Intergenic
915926634 1:160026504-160026526 TTGTTGTTGAATTTAGATGATGG + Intergenic
916093162 1:161325199-161325221 TTTTTTTAAAATAGAGATGAGGG - Intronic
916103614 1:161413666-161413688 TTTTTTTTTAATAGAGATGAGGG - Intergenic
916177633 1:162055822-162055844 TTTTTTTTTACTAGAGATGGGGG + Intergenic
916529586 1:165643691-165643713 TTATTTTTTAGTAGAGATGGGGG - Intronic
916977741 1:170099651-170099673 GTCTTTAAGAATAGAAATGAAGG - Intergenic
917011960 1:170484615-170484637 TTGTTTTTTAGTAGAGATGAGGG + Intergenic
917104241 1:171476291-171476313 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
917365955 1:174232472-174232494 TTTTTTTTTAATTGAGATGGGGG - Intronic
917470789 1:175324245-175324267 TTCTTTTTAAAGGGAAATGAAGG + Intronic
917506216 1:175629488-175629510 TTTTTTCTGTATAGAGATGTGGG + Intronic
917544982 1:175955546-175955568 TTCATTTGCAAAAGAGATGATGG + Intronic
917564408 1:176197237-176197259 TAAGTTTTTAATAGAGATGAGGG - Intronic
919621323 1:199867260-199867282 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
919771158 1:201159584-201159606 TTTTTTTTTTAAAGAGATGAGGG + Intronic
919868392 1:201801491-201801513 ATTTTTTTAAATAGAGATGAGGG + Intronic
919904227 1:202066896-202066918 TATTTTTTTAGTAGAGATGAGGG + Intergenic
919994347 1:202734284-202734306 TTTTTTTTTAATAGAGATAATGG - Intronic
920607658 1:207405435-207405457 TTTTTTTTTAGTAGAGACGAGGG + Intergenic
920810287 1:209278932-209278954 TTGTATTTTAATAGAGATGGGGG - Intergenic
921024633 1:211265983-211266005 GTATTTGTGAAGAGAGATGATGG + Intronic
921059811 1:211576355-211576377 TTCTTTTTAAGTGGTGATGAAGG + Intronic
921448656 1:215276607-215276629 TTCTTTTAGAATGGTGATGAAGG + Intergenic
921622412 1:217340472-217340494 TTTTATTTTTATAGAGATGAGGG + Intergenic
922059245 1:222071982-222072004 TTCTTTTTGAGCAGAGCTGGAGG - Intergenic
922288703 1:224192197-224192219 TTTTTTTTTAAGAGAGAGGAGGG + Intronic
923006021 1:230050543-230050565 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
923152776 1:231248553-231248575 TTTTTTTTCAATAGAGACGGGGG - Intronic
923196381 1:231672405-231672427 ATTTTCTTTAATAGAGATGAAGG + Intronic
923199499 1:231697620-231697642 TTTTTTTTGGGTAGAGATGAGGG + Intronic
923498941 1:234548783-234548805 TTGTTTTTGAAAAGAGTTAATGG - Intergenic
923546898 1:234929798-234929820 TCCTTCTTTAATAGGGATGATGG + Intergenic
923576456 1:235163003-235163025 TTTTTTTTAAATAGAGATTGGGG + Intronic
923627285 1:235624282-235624304 TTTTTTTTTAGTAGAGATGGGGG + Intronic
923693373 1:236220015-236220037 TTTTTTTTTAAAAGAGATGAGGG - Intronic
924095056 1:240542430-240542452 TTTTTTTTTAGTAGAGATGGGGG - Intronic
924229697 1:241953194-241953216 TTTTTTTTTTATAGAGATGGGGG - Intergenic
924503436 1:244658103-244658125 TATTATATGAATAGAGATGAGGG - Intronic
924685224 1:246282293-246282315 TTTTTTTTTTGTAGAGATGAGGG - Intronic
924911734 1:248520834-248520856 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1063400746 10:5742949-5742971 TTATTTTTGAAGACAGATGCTGG + Intronic
1063635327 10:7776882-7776904 TTTTTTTTTAATAGAGATGGGGG - Intronic
1063670359 10:8095220-8095242 TTTTTTTTTAATAGAGACAAGGG - Intergenic
1063799789 10:9561717-9561739 TTCTTTTTGGAAAGAGAATAGGG - Intergenic
1063874764 10:10462644-10462666 TTCTTTTTTTAAAGAGCTGAAGG + Intergenic
1063918181 10:10905568-10905590 TTTTTTTTAAGTAGAGATGGGGG - Intergenic
1064072019 10:12238700-12238722 TTAATTTTTAGTAGAGATGAGGG - Intronic
1064279062 10:13934475-13934497 TTTTTTTTAAATGGAGATGCTGG + Intronic
1064877427 10:20010329-20010351 TTCTTTTAGCATATTGATGAGGG + Intronic
1065011602 10:21426120-21426142 TTGTTTTGGAATAGAAATAAAGG - Intergenic
1065380277 10:25083066-25083088 GTCTTTTTGAGTAGGGATGAGGG + Intergenic
1065504917 10:26420330-26420352 TTATTTTTTAATTGAGATGGGGG - Intergenic
1065681586 10:28239317-28239339 TTTTTTTTTAATAGAGACGGGGG + Intronic
1065752250 10:28897376-28897398 TTCTTTTTGGAAAGAGAGGGAGG - Intergenic
1065918820 10:30373545-30373567 TTTTTTTTAAATGGAGATGGTGG - Intronic
1065927968 10:30452849-30452871 TTTTTTTTCAGTAGAGATGCAGG + Intronic
1065979386 10:30876525-30876547 TTCTTTTTAAATGGATATCAGGG + Intronic
1066270745 10:33820298-33820320 TTCTTTTTTAGTAGAGACGGGGG + Intergenic
1066359585 10:34717245-34717267 GTCCTTTTGTATAGAAATGAGGG + Intronic
1066387460 10:34953301-34953323 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1067181683 10:43992015-43992037 TTCTCTTTGACGAGAGAAGAAGG - Intergenic
1067547000 10:47199517-47199539 ATCTCTTTAATTAGAGATGAAGG + Intergenic
1068135195 10:52946232-52946254 ATGCTTTTGAATATAGATGATGG - Intergenic
1068431420 10:56936838-56936860 TTTTTTTGGAAGAGACATGAAGG + Intergenic
1068486333 10:57663710-57663732 TTATTTTTTTATAGAGATAATGG + Intergenic
1068984665 10:63096035-63096057 TTATTTTTTAAGAGAGATGGGGG - Intergenic
1069333012 10:67316026-67316048 TTCTTTTTGAATAGTGATAATGG + Intronic
1069455442 10:68550332-68550354 GGCTTTGTGAATGGAGATGATGG - Intergenic
1069528310 10:69194332-69194354 TTTTTTTTCTTTAGAGATGAGGG - Intronic
1069661962 10:70129134-70129156 TTTTTTTTTTGTAGAGATGAGGG + Intronic
1070005982 10:72424488-72424510 TTTTTTGTAAATAGAGATGGGGG + Intronic
1070006884 10:72433111-72433133 GTATTTTTTAGTAGAGATGAGGG + Intronic
1070074582 10:73122752-73122774 TTTTTTTTTAATAGAGATGGGGG + Intronic
1070178485 10:73992980-73993002 TTTTTTTTCAATAGAGACAAGGG - Intergenic
1070432696 10:76357239-76357261 TTCTTCTTGAATAGAGCTGGGGG + Intronic
1070434455 10:76376003-76376025 GTTTTTTTTAATAGACATGAGGG + Intronic
1070667189 10:78353621-78353643 TTATTTTTGAAGCTAGATGAGGG - Intergenic
1071032542 10:81202572-81202594 TTCTTTTTAAATTCAGTTGAAGG - Intergenic
1071115541 10:82214640-82214662 TTTTTTTTGCACAGAGATGGGGG + Intronic
1071254745 10:83861704-83861726 TTTATTTTTAGTAGAGATGAGGG - Intergenic
1071453789 10:85826155-85826177 TTTTTTTTTAGTAGAGATGAGGG - Intronic
1071535228 10:86423299-86423321 TTTTTTTTTAATAGAAATGGGGG - Intergenic
1071695976 10:87871671-87871693 TTTTTTTTCAGTAGAGATGGGGG + Intronic
1071958925 10:90789079-90789101 TCCTTCTTCAACAGAGATGATGG + Intronic
1072048130 10:91677588-91677610 TTATTTTTTAGTAGAGATGGGGG - Intergenic
1072117661 10:92379339-92379361 GTCATTTTTAAAAGAGATGATGG - Intergenic
1072196414 10:93120413-93120435 GTCTTTCTGAAGAGAGAGGAGGG + Intergenic
1072213929 10:93272343-93272365 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1072417364 10:95260391-95260413 TTCTCTTTTAATTGAGTTGAGGG - Intronic
1073168143 10:101476633-101476655 TTTTTTTTAAATAGAAATGTGGG + Intronic
1073199431 10:101723114-101723136 ATTTTTTTAAATAGAGATGGGGG - Intergenic
1073211899 10:101810861-101810883 TTTTTGTTTAGTAGAGATGAGGG + Intronic
1074318373 10:112379094-112379116 CTCTGTTTAAATAGAAATGAGGG + Intronic
1074541118 10:114365905-114365927 TTTTTTTTGTATAGAGATGGGGG + Intronic
1074989944 10:118696118-118696140 TTATGTTTGAATATATATGATGG + Intronic
1075359931 10:121822041-121822063 TTCCTGATGAATAGAGATGTGGG - Intronic
1075371400 10:121938769-121938791 TTCTTTCTGATTTGAGGTGATGG - Intergenic
1075384534 10:122045996-122046018 TTTTTTTTTAGTAGAGATGGGGG - Intronic
1078784786 11:14478400-14478422 TATTTTTTTAAGAGAGATGAGGG - Intronic
1079171371 11:18099105-18099127 TTGTTTTTTAAAAGAGATGGGGG + Intronic
1079513754 11:21242028-21242050 TTGTCTGTGAATAGATATGATGG + Intronic
1079950320 11:26793857-26793879 TTCTTTTAGAATAAAGGTGAAGG + Intergenic
1080054435 11:27891194-27891216 TTCTTTTTCCATTGAGATGTTGG + Intergenic
1080471110 11:32546457-32546479 TTTTTTTTTAATAGGGATGGGGG + Intergenic
1081130535 11:39373636-39373658 TGTTTTTTTAGTAGAGATGAGGG + Intergenic
1081801712 11:45864447-45864469 TTGTTTTTATTTAGAGATGAGGG - Intronic
1081913712 11:46717974-46717996 TTTTTTTTTGGTAGAGATGAGGG + Intergenic
1082018661 11:47512463-47512485 TTTTTTTTTTTTAGAGATGAGGG + Intronic
1082250327 11:49971748-49971770 TTTTTTTTTAATAGATATTAAGG - Intergenic
1083425218 11:62580778-62580800 TTTTTTTTTAGTAGAGATGGGGG + Intronic
1083792172 11:64992984-64993006 TTATTTTTTAATAGTGATGGGGG - Intronic
1084017662 11:66395463-66395485 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1084065203 11:66700125-66700147 TTTTTTTTTCATAGAGATGGGGG + Intronic
1084294761 11:68205132-68205154 TTTTTTTTTGGTAGAGATGAGGG - Intronic
1085252747 11:75154318-75154340 TTTTTTTTTAGTAGAGATGGGGG - Intronic
1085290811 11:75398196-75398218 TTCACTTTTCATAGAGATGAGGG + Intergenic
1086258778 11:84912633-84912655 TACTTTGTAAATGGAGATGACGG + Intronic
1087751920 11:102015648-102015670 GTTTTTTTAAATAGAGATGGGGG + Intergenic
1087958184 11:104315899-104315921 TGCATTTTTAGTAGAGATGAGGG + Intergenic
1088153709 11:106778654-106778676 TTCTTTTTTTTTTGAGATGATGG - Intronic
1088182491 11:107128117-107128139 TTCTTTTTTTAGAGAGTTGAGGG - Intergenic
1088258542 11:107923827-107923849 TTCTTTTTTAATAGAGATTGAGG + Intronic
1088619697 11:111669575-111669597 TTCTTTTTTAAAAGAGATGGAGG - Intronic
1088697303 11:112379047-112379069 TTGTTTTTTAGTAGAGATGGGGG + Intergenic
1088926324 11:114306874-114306896 ATCTTTTTAAATAGAAATGGAGG - Intronic
1090020494 11:123124186-123124208 TTCTTTTTTTGTAGAGATGGGGG + Intronic
1090058250 11:123441607-123441629 TTCTTTTATAATAGAGGTGGGGG - Intergenic
1090752833 11:129762579-129762601 TTATTTTTTAGTAGAGATGGGGG - Intergenic
1090849029 11:130555200-130555222 TCCTTTTGGAATAAAGAAGAAGG + Intergenic
1090931421 11:131301272-131301294 TTCTTTTTGGATAGAGAAATAGG - Intergenic
1091576835 12:1744751-1744773 TTATCTTTGGATAGATATGAGGG + Intronic
1092476750 12:8825769-8825791 TTCTATATGGAGAGAGATGAGGG + Intronic
1092787576 12:12041767-12041789 TTTTTTTTCTTTAGAGATGAGGG - Intergenic
1092997697 12:13965313-13965335 TTCTTTGAAAAAAGAGATGATGG - Intronic
1093124034 12:15307013-15307035 TTCTGTTTGAAAAAAGAAGAGGG - Intronic
1093232197 12:16559778-16559800 TTCATTTTTTATAGAGATGATGG - Intronic
1093319232 12:17692124-17692146 TTCTTTTTAAATGGAGAAGGGGG + Intergenic
1093513008 12:19950490-19950512 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1093553490 12:20443746-20443768 TTCTTTTTGAAAAGAGAAATAGG + Intronic
1093859673 12:24148675-24148697 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1094230373 12:28095685-28095707 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1094369737 12:29725197-29725219 TTTTTTTTTAGTAGAGATGGGGG + Intronic
1094628077 12:32144877-32144899 TTGTATTTGAATAGAAAAGAGGG - Intronic
1095045492 12:37499565-37499587 TTCTTTTTTAATAGTAGTGATGG + Intergenic
1095246033 12:39922506-39922528 TTCTTTCTGAAGTGACATGAAGG + Intronic
1096055207 12:48645130-48645152 TTCTTTTTAATAAGAAATGATGG - Intergenic
1096338342 12:50775110-50775132 TTTTTTTTTAATTGAGATAATGG + Intronic
1096750594 12:53756427-53756449 TTTATTTTAAATAGAGATGGGGG + Intergenic
1097616346 12:61888651-61888673 TACTTTTTGAATAAAAATTAGGG + Intronic
1097902329 12:64885594-64885616 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1098116266 12:67180099-67180121 TTCTTTTTAAATAGAGATAGAGG - Intergenic
1098283374 12:68883920-68883942 TTTTTTTTTAGTAGAGATGGGGG - Intronic
1098549477 12:71747380-71747402 TTTTTTCTTAATAGAGATGGAGG - Intergenic
1098875166 12:75859389-75859411 TACTTTTTGAAAACAGATGAAGG - Intergenic
1099437052 12:82657812-82657834 TACTATTAGAACAGAGATGAAGG - Intergenic
1099630034 12:85131035-85131057 TTTTTTTTTAGTAGAGATGAAGG - Intronic
1099956699 12:89358058-89358080 TTCTTTTGGAAAGGAGTTGACGG + Intergenic
1100387560 12:94118045-94118067 TTTATTTTTAATAGAGACGAGGG - Intergenic
1100777167 12:97988110-97988132 TTTTTTTTAAGTAGAGATGGGGG - Intergenic
1100835346 12:98561843-98561865 TTTTTTTTAAATACAGATGGGGG + Intergenic
1100850381 12:98704135-98704157 TTGTTTTTTAATAGAAATGGGGG + Intronic
1101574691 12:105986641-105986663 TTTTTTTTAAATAGAAAAGAGGG - Intergenic
1101677440 12:106931258-106931280 TTTTTTTTTTAAAGAGATGAGGG - Intergenic
1101826267 12:108222664-108222686 ATTTTTTTTAATAGAGATGGAGG + Intronic
1101846961 12:108370372-108370394 TTTTATTAAAATAGAGATGAGGG - Intergenic
1101933400 12:109034552-109034574 TTCTTTTTTAATAGAGATGGGGG - Intronic
1101948508 12:109156355-109156377 TTTTTTTTAAGTAGAGATGGGGG - Intronic
1102128565 12:110506056-110506078 TGTGTTTTTAATAGAGATGAGGG + Intronic
1102228362 12:111245361-111245383 TTTTTTTTGGGTAGAGATGGGGG - Intronic
1102377701 12:112436686-112436708 TGCTTTTATAATAGAAATGAAGG + Intronic
1102598104 12:114008283-114008305 TTCTTTTTTGATAGAGATGGGGG + Intergenic
1103249905 12:119490569-119490591 TTTTTTTTTTAAAGAGATGAGGG + Intronic
1103453196 12:121044098-121044120 TTCTTGTTGACTATAGGTGAGGG + Intergenic
1103515665 12:121506627-121506649 ATCTTTTTTAGTAGAGATGGGGG - Intronic
1103652261 12:122442087-122442109 TTTATTTTTAGTAGAGATGAGGG + Intergenic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1103884429 12:124190052-124190074 TTTTTTTTTAGTAGAGATGGGGG + Intronic
1103983046 12:124749186-124749208 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1104029294 12:125053025-125053047 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1104036898 12:125104025-125104047 TTCATTTTGAATAGAGATTAAGG + Intronic
1104399602 12:128464578-128464600 TTCATTTTTTATAGAGATGGGGG - Intronic
1104836332 12:131794359-131794381 TTTTTTTTAAGTAGAGATGGGGG - Intronic
1105383574 13:19910039-19910061 TTTTTTTTTACTAGAGATGGGGG - Intergenic
1105758548 13:23492290-23492312 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1105955746 13:25281152-25281174 TTCTTTTTCTGTAGAGATGAGGG - Intronic
1106062229 13:26304839-26304861 TTATTATTTTATAGAGATGAGGG + Intronic
1106325304 13:28683629-28683651 TTATTATTGAAGACAGATGATGG - Intergenic
1106612463 13:31296656-31296678 CTATTTTTCAATAGAGATGATGG + Intronic
1106872497 13:34037004-34037026 TTCTTTTAGTATAGCTATGATGG + Intergenic
1107027889 13:35822331-35822353 TTTTTTTTGTGTAGAGATGGGGG + Intronic
1107111486 13:36702635-36702657 TTCTACTTTGATAGAGATGAAGG - Intergenic
1107252951 13:38387820-38387842 TGCATTTTTAGTAGAGATGAGGG + Intergenic
1107282580 13:38753991-38754013 TTATTTTTGAATGGAGCTGGGGG + Intronic
1107529245 13:41266152-41266174 TTTTTTTTAAATAGAGATGGGGG + Intergenic
1107890584 13:44910796-44910818 TTTCTTTTCAGTAGAGATGAAGG - Intergenic
1107903605 13:45042313-45042335 TTGTGTTTTAGTAGAGATGAGGG - Intergenic
1108159421 13:47622503-47622525 ATCTTTTTGACAAGAGATAAGGG - Intergenic
1108192321 13:47954896-47954918 TTATTTTTGAGTAGAGGAGAGGG - Intronic
1108399844 13:50029042-50029064 TTTTCTTTGATTAGAAATGAGGG + Intergenic
1109120618 13:58451635-58451657 TTTTTTTTAAGTAGAGATGGGGG + Intergenic
1109310315 13:60685098-60685120 TTGTTTTTTACTTGAGATGAGGG + Intergenic
1110222563 13:73089221-73089243 TTTTTTAATAATAGAGATGAGGG + Intergenic
1110599984 13:77361829-77361851 TTGTTTTTTGATAGAGATGGGGG + Intergenic
1111043343 13:82780983-82781005 TTCTTTTTGGAAAGAAATGGAGG - Intergenic
1111867767 13:93791066-93791088 TTCATTTGGAATAGAAATGCAGG - Intronic
1111905213 13:94247830-94247852 TTCTTTTTTTAAAGAGATGGGGG + Intronic
1112430589 13:99347103-99347125 TTTTCTTTAAATAGAGATGGGGG - Intronic
1112808458 13:103188588-103188610 TTCTTTGTAAATAGAGCTTAAGG - Intergenic
1113682469 13:112254047-112254069 TTGTTTTTGAAAATAGGTGACGG + Intergenic
1113725438 13:112596285-112596307 TTCTTTTGGGATAGGTATGATGG + Intergenic
1114178193 14:20342899-20342921 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1114556007 14:23562731-23562753 TTTTTTTAAAATAGAGATGGGGG - Intronic
1114637778 14:24197894-24197916 TTCTATTTGAATACAGAATAGGG - Intronic
1115245378 14:31288912-31288934 TTTTTTTTTAATAGAGATGGTGG - Intergenic
1115501585 14:34054523-34054545 CTCTTTTTAAATACAGATGCTGG - Intronic
1115531266 14:34330014-34330036 TTTTTTTTTAATAGAGATGGGGG - Intronic
1115595176 14:34902284-34902306 CTTCTTTTGAATAGAGATGTGGG + Intergenic
1115913750 14:38286367-38286389 TTCTATTTTAATAGATATTAGGG + Intergenic
1115969478 14:38929360-38929382 TTGTTTTTAAGTTGAGATGAGGG - Intergenic
1116004412 14:39277205-39277227 GTTTTTTTTAAAAGAGATGAGGG + Intronic
1116508485 14:45714799-45714821 TTCTTCTTACATAGAGAAGAGGG + Intergenic
1116882604 14:50186606-50186628 TTTTTTTTAAATATAGATGGGGG - Intronic
1117249714 14:53924343-53924365 TTCATCTTGGATAGAGATTAAGG - Intergenic
1117604825 14:57417493-57417515 TTCTTTTTAAATTCAGATAACGG - Intergenic
1117608885 14:57462434-57462456 TTCTTTTTTGGTAGACATGAGGG - Intergenic
1117700655 14:58410042-58410064 TTATTTTTTAGTAGAGATGAGGG + Intronic
1117923765 14:60754248-60754270 TTTTGTTTTAATAAAGATGAAGG - Intronic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1117991981 14:61442756-61442778 TTTTTTTTTAATAGAGATGGAGG - Intronic
1117993234 14:61455211-61455233 TTTTTTTTTAGTAGAGATGGGGG + Intronic
1118588465 14:67379926-67379948 TTTCTTTTTAATAGAGATGGAGG + Intronic
1118881980 14:69836703-69836725 TATTTTTTTAATAGAGATGGTGG - Intergenic
1119216051 14:72869878-72869900 TTTTTTTTCCCTAGAGATGATGG + Intronic
1119222069 14:72916886-72916908 TTTATTTTTCATAGAGATGAGGG - Intergenic
1119253731 14:73180156-73180178 TGCATTTTTAGTAGAGATGAGGG + Intronic
1119393510 14:74308240-74308262 TTCTTTTTTTGTAGAGATGGGGG - Intronic
1119499349 14:75110361-75110383 TTCTTTTGGTAGAGAGATGGAGG - Exonic
1119506151 14:75174865-75174887 TTGTATTTTAGTAGAGATGACGG - Intronic
1119635100 14:76267255-76267277 GTATTTTTTAATAGAGATGGGGG + Intergenic
1119676305 14:76557980-76558002 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1119927357 14:78507935-78507957 TTCTCTTTATACAGAGATGAAGG + Intronic
1120129655 14:80790268-80790290 TTCTTTTTTAATATGGATAATGG - Intronic
1120858147 14:89230834-89230856 TTGTTTCTCAATGGAGATGAAGG + Intronic
1120968634 14:90189688-90189710 TTCTTCTTGAATGAAGAAGAAGG - Intergenic
1121239295 14:92416538-92416560 GTGTTTTTGAAGAGAGGTGATGG + Intronic
1121882335 14:97512056-97512078 ATGTTTCTGAATAGTGATGAGGG - Intergenic
1121982347 14:98465920-98465942 TTCTTTGTGAAGAGAAAGGAAGG + Intergenic
1122236884 14:100335968-100335990 TTTTTTTTTAAAAGAAATGAGGG + Intronic
1122478672 14:102030943-102030965 TTATTTTAAAATAGAGATGGGGG - Intronic
1122520623 14:102341136-102341158 GTCTTTGTGAATAGAGAATAGGG + Intronic
1122580704 14:102769957-102769979 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1122606802 14:102952173-102952195 TTTTTTTTGTAGAGAGTTGAGGG - Intronic
1122681620 14:103468799-103468821 TTTTTTTTAAATGGAGATGGGGG + Intronic
1122755501 14:103975953-103975975 TCCTTTTTAAAGAGAGATGAGGG - Intronic
1122998509 14:105278731-105278753 TTTTTTTTAAATAGAGATGGGGG - Intronic
1123456516 15:20431229-20431251 TTGTTTTTAAATTCAGATGATGG - Intergenic
1123661546 15:22569133-22569155 TTGTTTTTAAATTCAGATGATGG + Intergenic
1124262655 15:28206376-28206398 TTGTTTTTAAATTCAGATGATGG - Exonic
1124315346 15:28663362-28663384 TTGTTTTTAAATTCAGATGATGG + Intergenic
1124406595 15:29398412-29398434 TTCTTTTTTAAAAGAGAGGATGG - Intronic
1125089643 15:35775175-35775197 TTCTTTTTCAAAAAAGATTATGG - Intergenic
1125573521 15:40739178-40739200 TTGTTTCTGAAGACAGATGATGG - Intronic
1125691093 15:41596808-41596830 TTTTTTTTTAATAAAGATGAGGG + Intergenic
1125905489 15:43388021-43388043 TTGTATTTTAATAGAGATGGGGG + Intronic
1125961014 15:43830018-43830040 TTTTTTTTTAATGGAGATGTTGG + Intronic
1126009013 15:44284997-44285019 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1126009937 15:44292986-44293008 TTATTTTTTGGTAGAGATGAGGG + Intronic
1126509930 15:49458998-49459020 GTGTTTTTTAATAGAAATGAAGG - Intronic
1126813246 15:52429775-52429797 TTAATTTTTAATAGAGATGGGGG + Intronic
1126944041 15:53798186-53798208 TTCTTTTTGTTTACAGATGTTGG - Intergenic
1127051032 15:55084536-55084558 TTGTTGTTGAATCAAGATGAGGG - Intergenic
1127282633 15:57504920-57504942 TTCCTTTTTAAAACAGATGAGGG + Intronic
1127721859 15:61709847-61709869 TGCATTTTTAATAGAGATGGGGG + Intergenic
1127879077 15:63139921-63139943 TTTTTTTTTGGTAGAGATGAAGG - Intronic
1128161334 15:65424518-65424540 TTTTTTTTTAATAGAAATGGGGG - Intergenic
1128200722 15:65804399-65804421 TTCATTTTTAGTAGAGATGGGGG - Intronic
1128911724 15:71521659-71521681 TTCTTTTAGAACACAAATGAGGG - Intronic
1129026111 15:72575870-72575892 TTGTTTTTTCATTGAGATGAGGG + Intronic
1129746126 15:78022719-78022741 TTTTTTTTGTATAGAGACGGGGG + Intronic
1129811129 15:78510977-78510999 TTTTTTTTAAATAGAGAAGCGGG + Intronic
1129919196 15:79305170-79305192 ACCTTGTAGAATAGAGATGATGG + Intergenic
1130175122 15:81560251-81560273 ATATTTTTGAGGAGAGATGATGG + Intergenic
1130207921 15:81895124-81895146 TTTTTTTTTTATAGAGATGGGGG - Intergenic
1130394426 15:83489683-83489705 TTCCTTTTAAATAGAGATAGAGG - Intronic
1130514615 15:84616778-84616800 TTCTTCTAGAAGAGAGATGCTGG + Intronic
1131161128 15:90105558-90105580 TTTTTTTAAAATAGAGATTAAGG - Intergenic
1131169798 15:90169752-90169774 TTTTTTTTAAATAGAGTTGGGGG - Intronic
1131212438 15:90509514-90509536 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1131981694 15:98000515-98000537 TTGTATTTGAATAAAGATAATGG - Intergenic
1132610887 16:815806-815828 TTTTTTTTTGATAGAGACGAGGG + Intergenic
1133049471 16:3108901-3108923 TTGTTTTTAAATAGAGTTGGGGG + Intergenic
1133081586 16:3325289-3325311 TTATTTTTTAATAGAGATAGGGG + Intergenic
1133142437 16:3757043-3757065 TTCTTTTCAAATAGAGATGGGGG + Intronic
1133583128 16:7165870-7165892 TTATTCTTGAATAGATATGTTGG + Intronic
1133636125 16:7667487-7667509 TTCGTTTTTAAAAGAGATGATGG + Intronic
1133742215 16:8660349-8660371 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1133793255 16:9025831-9025853 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1133968924 16:10553180-10553202 TTATTTTGGTATAGAGATGCAGG - Intronic
1134265242 16:12686880-12686902 TTTTTTTTGAAAAGAACTGATGG + Intronic
1134466140 16:14479412-14479434 TTTTTTTTTAATAGAGATGGGGG - Intronic
1134680653 16:16122698-16122720 TTTTTTTTTAAGAGAGATGGGGG - Intronic
1135273810 16:21093034-21093056 TTGTTTTTAAATTGAGATGAGGG - Intronic
1135401321 16:22168220-22168242 TTATTTTTAAATAGAGATAGGGG - Intronic
1135406689 16:22203494-22203516 TTGTTTTTTTGTAGAGATGAGGG + Intergenic
1135578226 16:23602686-23602708 TTGTATTTTAATAGAGATGGGGG - Intergenic
1135693460 16:24565289-24565311 TTCTTTTGGAAAAGAGACGGTGG - Intronic
1135710689 16:24714476-24714498 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1135730552 16:24891494-24891516 TTATTTTTTAGTAGAGATGCAGG + Intronic
1135783311 16:25325466-25325488 TTCTTTATGAAAACAGATGATGG + Intergenic
1136137439 16:28265239-28265261 TCTTTTTTTAATAGAGATGGGGG - Intergenic
1136144542 16:28308599-28308621 TTCTTTGTAGATAGAGATGGAGG + Intronic
1136319361 16:29472611-29472633 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1136343330 16:29659555-29659577 TTCTTTTTTGGTAGAGATGAGGG + Intergenic
1136433932 16:30211955-30211977 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1136509268 16:30725795-30725817 TTTTTTTTAAATACAGATGGGGG + Intronic
1136529179 16:30855749-30855771 TTCTTTTTAAATAGAGACAGGGG - Intronic
1136542909 16:30938340-30938362 TTCTTTTTTAATAGAGATGGGGG - Intronic
1136566130 16:31071624-31071646 TTCTTTGTATATAGAGATGGAGG + Intronic
1136725662 16:32355237-32355259 TCTTTTTTTAATCGAGATGAAGG - Intergenic
1137737928 16:50738817-50738839 TCTCTTTTGAGTAGAGATGAGGG - Intergenic
1137937831 16:52651495-52651517 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
1138031180 16:53560586-53560608 TTTTTTTTAAATAGAGACAAGGG + Intergenic
1138056834 16:53843821-53843843 TTTTTTTTTAATAGAGATGGGGG + Intronic
1138561703 16:57804763-57804785 TTTTTTTTAAGTAGAGATGGGGG + Intronic
1138577545 16:57917787-57917809 TTTTTTTTAAGTAGAGATGGGGG - Intronic
1138993533 16:62420708-62420730 TTCATTTTGAATAAATATAAAGG + Intergenic
1139723945 16:68880693-68880715 TTCTTTTTTTGTAGAGATGGTGG + Intronic
1139762821 16:69200685-69200707 TTGTTTTTAAATAGAGATGGGGG + Intronic
1139772648 16:69291537-69291559 TTTTTTTTAAATAGAGATGGGGG - Intronic
1139842683 16:69894251-69894273 TTTTTTTTTGGTAGAGATGAGGG + Intronic
1140142772 16:72274424-72274446 TTTTTTTTTTGTAGAGATGAGGG + Intergenic
1140177452 16:72677080-72677102 TTCATTATGAATATAGATGCAGG + Intergenic
1140214498 16:72996546-72996568 CTCTTTTTGTAGAGAGTTGATGG - Intronic
1140355247 16:74299698-74299720 CTTTTTTGGAATAAAGATGATGG - Intronic
1140447691 16:75044536-75044558 TTTTTTTTAAATAGAGATGGGGG + Intronic
1140528002 16:75640028-75640050 TTCTTTCTGTATAGATATAATGG + Intronic
1140717115 16:77736636-77736658 TTTTTTTTTTATAGAGATGGGGG + Intronic
1141096527 16:81167012-81167034 TTCTTCCTGAATGGAGGTGATGG + Intergenic
1141286040 16:82673010-82673032 TTTTTTTTTTGTAGAGATGATGG + Intronic
1141455986 16:84142616-84142638 TTCTTTTTTAGTAGAGACGGGGG + Intronic
1141596427 16:85099813-85099835 TTTTTTTTTAGTAGAGATGGGGG + Intronic
1203000768 16_KI270728v1_random:162517-162539 TCTTTTTTTAATCGAGATGAAGG + Intergenic
1203132371 16_KI270728v1_random:1698922-1698944 TCTTTTTTTAATCGAGATGAAGG + Intergenic
1142550529 17:735790-735812 TTCTTTTTAAGTAGCGATGGGGG - Intronic
1142678160 17:1528437-1528459 TTCTTTTTAAATACAGTTTAAGG - Intronic
1142835003 17:2578889-2578911 TTAATTTTTAATAGAGATGGGGG - Intergenic
1143246464 17:5490208-5490230 TTCTTTTTTATTAAAGATCAAGG - Exonic
1143343179 17:6230060-6230082 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1143656820 17:8299529-8299551 TTTTTTTTTAGTAGAGATGAGGG - Intergenic
1144580243 17:16454794-16454816 TTCTTTTTTTAAAGAGATGGGGG + Intronic
1145399366 17:22518469-22518491 TTTTTTTTTTTTAGAGATGATGG - Intergenic
1145899865 17:28483453-28483475 TTTTTTTTTTGTAGAGATGAGGG - Intronic
1145926523 17:28651234-28651256 GTATTTTTTAATAGAGATGGGGG + Intronic
1145958374 17:28870695-28870717 TTTTTTTTAAATAGAGATAGAGG + Intergenic
1146027394 17:29333229-29333251 TTTTTTTTTAGTAGAGATCAAGG + Intergenic
1146596117 17:34170538-34170560 TGTTTGTTGAATGGAGATGATGG - Intronic
1146715850 17:35086469-35086491 TTTTTTTTTAATTGAGATGGGGG - Intronic
1146727199 17:35166076-35166098 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1146778467 17:35644556-35644578 TTTTTTTCCAGTAGAGATGAGGG + Intronic
1147362271 17:39938522-39938544 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
1147601064 17:41745819-41745841 TTTTTTTTAAATAGAGATGGGGG - Intergenic
1147777641 17:42914105-42914127 TTTTTTTTTAATAGAGATGGGGG + Intergenic
1147981535 17:44277627-44277649 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1148039425 17:44694915-44694937 TTCTTTTTAAATAGTGATGGTGG - Intergenic
1148890592 17:50804475-50804497 TTTTTTTTTTATGGAGATGAGGG + Intergenic
1150096418 17:62380173-62380195 TGTATTTTTAATAGAGATGAGGG + Intronic
1150108961 17:62481110-62481132 TTCTTTTTCAGCAGAAATGATGG + Exonic
1150341545 17:64372234-64372256 TCTTTTTTAAATAGAGATTAGGG - Intronic
1150525326 17:65916717-65916739 TTTTTTTTTAATAGAGATGGGGG + Intronic
1150616745 17:66778206-66778228 ACCGTTTTTAATAGAGATGATGG - Intronic
1150859182 17:68783780-68783802 TTTTTTGTCAGTAGAGATGAAGG - Intergenic
1151016473 17:70559932-70559954 TTCTTTTATTTTAGAGATGAGGG - Intergenic
1151342072 17:73477872-73477894 TCCTCGTTGAATAGAGATTAAGG - Intronic
1151694930 17:75709779-75709801 TTTTTTTTTAGTAGAGATGAGGG - Intergenic
1152194508 17:78909346-78909368 TTTTTTTTTTAAAGAGATGAGGG - Intronic
1152274286 17:79346093-79346115 TGCATTTTTAGTAGAGATGAGGG + Intronic
1152500526 17:80705705-80705727 TTATTTTTCAGTAGAGACGAGGG + Intronic
1153085973 18:1287965-1287987 TTCTATTTGAATTGTTATGAAGG - Intergenic
1153305501 18:3627111-3627133 TTTTTTTTTAATAGAGATGAGGG + Intronic
1153444209 18:5154057-5154079 TTAATTTTTCATAGAGATGAGGG - Intronic
1153822473 18:8844136-8844158 TTCTAATTGAATGGGGATGAGGG - Intergenic
1154215989 18:12416486-12416508 TTCTGTTTTTGTAGAGATGAGGG + Intronic
1154977164 18:21470110-21470132 TTTTTTTTTAATAGAAATGGGGG - Intronic
1154998306 18:21662276-21662298 TGCATTTTTAATAGAGATGGGGG + Intronic
1155014420 18:21818629-21818651 TTCTTTTTTTGTAGAGATGGGGG - Intronic
1155153570 18:23140609-23140631 GTATTTTTTAGTAGAGATGAGGG + Intronic
1155207302 18:23571343-23571365 TTATTTTTTTCTAGAGATGAGGG - Intronic
1155443403 18:25885140-25885162 TTCATCTTGAATAAAGAAGAGGG + Intergenic
1155451779 18:25971059-25971081 TTCTTTTTAAATAGAAGTAAAGG - Intergenic
1155469835 18:26179910-26179932 TTTTTTTTTCATAGAGATGGGGG - Intronic
1155986716 18:32237969-32237991 TTCTTTTTTTTTAGAGATGGAGG - Intronic
1156593700 18:38521319-38521341 TTGTTTTTGAAAAGAGTTAATGG - Intergenic
1156640477 18:39089404-39089426 TTCTTATTGATTAGAGAGTAGGG - Intergenic
1156882843 18:42101384-42101406 TTCTTTTTGAATATGACTGATGG + Intergenic
1156991127 18:43408775-43408797 TTCTTTTTGAACATAGAATATGG - Intergenic
1157875072 18:51265321-51265343 CTTTTTTTTAATAGAGATGGGGG - Intergenic
1158004372 18:52655129-52655151 TTTTTTTTTAAGAGAGAAGAGGG + Intronic
1158158767 18:54455880-54455902 TTTTTTTTAAGTAGAGATGGGGG + Intergenic
1158421710 18:57300487-57300509 TACTTTTTTTATAGAAATGAGGG - Intergenic
1158481347 18:57824320-57824342 TTCTGCTTGAATAGAGGAGAGGG - Intergenic
1158623740 18:59054105-59054127 TTTTTTTTTTAAAGAGATGAGGG + Intergenic
1159649549 18:70961529-70961551 TTCTTTTTTCGTAGAGATGGTGG + Intergenic
1159795787 18:72841558-72841580 TTCATTTTCAGTAGAGATGGGGG - Intronic
1159967588 18:74610724-74610746 TTTTTTTTAAGTAGAGATGGGGG + Intronic
1160065135 18:75567197-75567219 CTCTTCTTCATTAGAGATGATGG - Intergenic
1160146946 18:76372975-76372997 TACATTTTTAGTAGAGATGAGGG - Intronic
1160580544 18:79882334-79882356 AATTTTTTTAATAGAGATGAGGG - Intronic
1160740634 19:683878-683900 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
1161081668 19:2313451-2313473 TTTTTTTTTTAAAGAGATGAGGG - Intronic
1161546144 19:4881429-4881451 TTTTTTTCAAATAGAGATGGGGG - Intergenic
1161693774 19:5753693-5753715 TTTTTTTTTAATAGAGACAAGGG - Intronic
1161798780 19:6403621-6403643 TTATTTTAGTATAGAGATGGGGG + Intergenic
1162088055 19:8260378-8260400 TTTTTTTTTAGTAGAGATGGGGG + Intronic
1162306001 19:9874337-9874359 TTTTTTTTTAAGAGAGATGGGGG + Intronic
1162447992 19:10735967-10735989 CTCTTTTTAGATAGAGATGGGGG + Intronic
1162498774 19:11039046-11039068 TTTTTTTTTAATAGAGACAAAGG - Intronic
1162612221 19:11765699-11765721 TTGTTTTTAAATAGAGATGGGGG + Intergenic
1162647280 19:12059016-12059038 TTCTTAATTAATAGAGATGTGGG + Intergenic
1162697943 19:12491317-12491339 TGTTTTTTGAATAGAGACGAGGG - Intronic
1162754693 19:12850734-12850756 TTCTTTTTCATTTGAGATGGAGG + Intronic
1162928811 19:13945336-13945358 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1163090338 19:15015011-15015033 TTATTTTAAAATATAGATGAGGG - Intronic
1163163845 19:15481784-15481806 TTAATTTTTTATAGAGATGAGGG + Intronic
1163357258 19:16821944-16821966 TTTTTTTTGAGTAAAGATGGGGG + Intergenic
1163639528 19:18453729-18453751 TTCATTTTTTGTAGAGATGAGGG + Intronic
1163702785 19:18794663-18794685 TTTTTTTAAAATAGAGATGGGGG + Intergenic
1164495109 19:28753685-28753707 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1165046230 19:33107251-33107273 CATTTTTTAAATAGAGATGAGGG + Intronic
1165051308 19:33143155-33143177 TTTTTATTTTATAGAGATGAGGG - Intronic
1165057228 19:33185446-33185468 TTTTTTTTTTATAGAGATGGGGG + Intronic
1165102767 19:33448594-33448616 TTCTCTTTTGATAGAGATGCTGG + Intronic
1165224276 19:34343279-34343301 TTAATTTTTAGTAGAGATGAGGG - Intronic
1165285027 19:34834481-34834503 TTTTTTTTAAAGAGAGATGGGGG - Intergenic
1165620996 19:37247658-37247680 TTTTTTTTCTGTAGAGATGAGGG - Exonic
1165659249 19:37560701-37560723 TTCGTTTTGAACAGTTATGATGG + Intronic
1165836636 19:38761027-38761049 TTATTTTCTAATAGAGATGGGGG - Intronic
1165905901 19:39194568-39194590 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1166079150 19:40432952-40432974 TTTTTTTTTAATAGAGACGAGGG + Intergenic
1166205550 19:41266462-41266484 TTTTTTTTAAATACAGATGGGGG + Intronic
1166383145 19:42365591-42365613 TTTTTTTTTTGTAGAGATGAGGG - Intronic
1166552843 19:43678119-43678141 TTTTTTTTTAATAGAGACGGTGG + Intergenic
1166726020 19:45028193-45028215 TTCTTTTTTGAGAGAGATGGGGG + Intronic
1166896707 19:46027450-46027472 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1166955113 19:46458731-46458753 TTTTTTTTAAATAGAGATGGGGG + Intergenic
1167279745 19:48559945-48559967 TTTTTTTTAAAGAGAGATGAGGG - Intronic
1167553917 19:50180771-50180793 TTTTTTTAAAATAGAGATGAGGG + Intergenic
1167567395 19:50265337-50265359 TTTTTTTTTTGTAGAGATGAGGG - Intronic
1167580912 19:50342162-50342184 TTCTTTTTTTGTAGAGATGGGGG - Intronic
1167614610 19:50525590-50525612 TTTTTTTTTAGTAGAGACGAGGG + Intronic
1167787893 19:51650896-51650918 TTTTTTTTAAGTAGAGATGAAGG + Intergenic
1167913591 19:52722916-52722938 TTTTTTTTTGATAGAGATGGGGG + Intronic
1168025547 19:53641025-53641047 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
1168303603 19:55421243-55421265 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1168322856 19:55520714-55520736 TTCTTTTTTAATAAAGATGGGGG - Intergenic
1168375584 19:55876533-55876555 GTTTTTTTTAGTAGAGATGAGGG + Intronic
1168415977 19:56168697-56168719 TTTATTTTTAGTAGAGATGAGGG + Intergenic
1202708389 1_KI270714v1_random:1764-1786 TGATTTTTCAGTAGAGATGAGGG + Intergenic
925224030 2:2167075-2167097 TTCTTTATGAATAATAATGAGGG + Intronic
925614001 2:5728066-5728088 TTCTAGATGAAAAGAGATGAAGG - Intergenic
926102310 2:10126150-10126172 TTTTTTTTTTAAAGAGATGAGGG - Intronic
926304643 2:11629081-11629103 TTCTTTGGGAGCAGAGATGAGGG - Intronic
926447808 2:12965516-12965538 TTCCTTTTTAATAGAGACCAGGG - Intergenic
926757342 2:16246738-16246760 TTTATTTTTAATAGAGATGGGGG - Intergenic
926775757 2:16421222-16421244 TGCTTTTTTAATAGAAAGGAAGG + Intergenic
926809429 2:16743242-16743264 TTCATTTTTAGTAGAGATGTGGG - Intergenic
927890538 2:26745388-26745410 TTTTTTTTTAATAGAGATGGGGG + Intergenic
927923926 2:26996327-26996349 TTTATTTTTAGTAGAGATGAAGG + Intronic
927948783 2:27153544-27153566 TTCTTTTTATGTAGAGATGGGGG + Exonic
928972370 2:37043917-37043939 TTTTTTTTAAATAGAAATGAAGG + Intronic
929124552 2:38511299-38511321 TCCTGTGTGAATTGAGATGATGG + Intergenic
929159256 2:38815234-38815256 ATTTTTTTGTAGAGAGATGAGGG + Intronic
929182811 2:39061686-39061708 TTCTTTTTAAAAATACATGAAGG - Intronic
929234839 2:39594670-39594692 TTTTTTTTTAATAGAGATGGTGG + Intergenic
929359756 2:41073290-41073312 TTCTTTTAGAATAGATCTGAAGG + Intergenic
929542606 2:42833994-42834016 TTTTTTTTAAATAGAGACGGGGG + Intergenic
929728247 2:44456227-44456249 TTCATTTTCACTAGTGATGAAGG + Intronic
930125471 2:47792861-47792883 TTTTTTTTTTAAAGAGATGACGG + Intronic
930222709 2:48761375-48761397 TTATTTTTTTGTAGAGATGAGGG + Intronic
930351457 2:50260977-50260999 TTCTTTTTCAATTGAAAAGAAGG - Intronic
930794595 2:55375195-55375217 TTGTTTGTGTGTAGAGATGAAGG - Intronic
931006321 2:57853940-57853962 TTCATTTTAAAAAGATATGAAGG - Intergenic
931385284 2:61792913-61792935 TTTTTTTTTTATAGAGATGGAGG - Intergenic
931672860 2:64664483-64664505 TTCTTTTTTTGTAGAAATGAGGG - Intronic
932016775 2:68036704-68036726 TTTTGTTTTAATAGAGATGGAGG + Intergenic
932195811 2:69782525-69782547 TTTATTTTTTATAGAGATGAGGG + Intronic
932488590 2:72103991-72104013 TTCTGTTTCAAGAGATATGAGGG - Intergenic
932516417 2:72354701-72354723 TTCTTTTTGACTACAGATGATGG - Intronic
932528109 2:72495028-72495050 TTTTTTTTCTATAGAGATGGGGG + Intronic
932919882 2:75899881-75899903 TTCTTTTAGAATTGAAAAGAAGG + Intergenic
933192080 2:79345870-79345892 TTTTTTTTTAATACAGATGGGGG + Intronic
933646534 2:84817593-84817615 TTTTTTTTTAATTGAGATGGGGG - Intronic
933814884 2:86058413-86058435 TTTTTTTTAAATAGAGATGGGGG + Intronic
933903581 2:86867173-86867195 TTCTTTTTTAATAGAGATGGGGG - Intergenic
933904400 2:86875936-86875958 TTGTTTTTTAATAGAGATGGGGG + Intergenic
934011810 2:87827758-87827780 TTCTTTTTGCATGGAGAGAAAGG - Intergenic
934069306 2:88368951-88368973 TTAATTTTTAATAGAGATGAGGG + Intergenic
934073299 2:88405836-88405858 TTATTTTTTAGTAGAGATGGGGG - Intergenic
934146094 2:89095352-89095374 GTCGTTTTGGATTGAGATGAGGG + Intergenic
934147814 2:89112719-89112741 GTCGTTTTGGATTGAGATGAGGG + Intergenic
934221459 2:90087889-90087911 GTCGTTTTGGATTGAGATGAGGG - Intergenic
934223167 2:90105223-90105245 GTCGTTTTGGATTGAGATGAAGG - Intergenic
935300209 2:101687122-101687144 TTTTTTTTCAGTAGAGATGGGGG - Intergenic
935382982 2:102471890-102471912 TTCTTTCTAAAAAGAAATGAGGG - Intergenic
935615047 2:105069836-105069858 TTTTTTTTTTGTAGAGATGAGGG - Intronic
935680232 2:105629539-105629561 TTTTATTTGAAAAGTGATGATGG - Intergenic
935776934 2:106481791-106481813 TTCTTTTTTAATAGAGATGGGGG + Intergenic
935987754 2:108691008-108691030 TTCTTTTTTTGTAGAGATGGGGG + Intergenic
936033358 2:109089428-109089450 TTTTTTTTAAATAGAGATGGGGG - Intergenic
936367842 2:111876215-111876237 TTGTTTTTTAATAGAGATGGGGG - Intronic
936455724 2:112672572-112672594 TTTTTTTTTAATTGAGATGGGGG + Intergenic
936785581 2:116090249-116090271 TTGTTTATGAAAAGAGATGGGGG + Intergenic
938283031 2:130080672-130080694 TTCTTTTTGAACATAGTTAATGG + Intronic
938333659 2:130469226-130469248 TTCTTTTTGAACATAGTTAATGG + Intronic
938356155 2:130651441-130651463 TTCTTTTTGAACATAGTTAATGG - Intronic
938432579 2:131258227-131258249 TTCTTTTTGAACATAGTTAATGG - Intronic
938954988 2:136289007-136289029 TTTATTTTTTATAGAGATGAGGG + Intergenic
939387883 2:141524743-141524765 TTCTTTTTCATAAGAGTTGATGG - Intronic
939518943 2:143204925-143204947 TTTTTTTTTAAGAGAGATTAGGG - Intronic
940709674 2:157146384-157146406 TGCTTTTTAAAAAGAGAAGAAGG + Intergenic
940893629 2:159059329-159059351 TTATTTTTTCATAGAGATGGAGG - Intronic
941087638 2:161136189-161136211 TTCCTTTTTATTACAGATGAGGG - Intergenic
941146040 2:161847062-161847084 TATTTTTTTAATAGAGATGGGGG - Intronic
941201781 2:162520586-162520608 TTGTTTTTTTATAGAGATGGGGG - Intronic
941578112 2:167261337-167261359 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
941900108 2:170669980-170670002 TTTTTTTAAACTAGAGATGAGGG + Intergenic
942304696 2:174595076-174595098 TTTTTTTTTTGTAGAGATGAGGG - Intronic
942568796 2:177292663-177292685 TTCTTTTAGACTAAAGATGCAGG + Intronic
942969721 2:181943357-181943379 TCCTGTTTGAATAGTGATGAAGG + Intergenic
942999614 2:182309572-182309594 TATTTTTTGATTAGAGATCATGG - Intronic
943269706 2:185783408-185783430 TTCATTTTTAAAAAAGATGATGG - Intronic
943813962 2:192227518-192227540 TTATTTTAGAAGATAGATGATGG - Intergenic
943965961 2:194333024-194333046 TTCTTTTTGAATGGAGTGCATGG + Intergenic
944118125 2:196210794-196210816 TTTTTTTTAAGTAGAGATGGGGG + Intronic
944452530 2:199857481-199857503 TTTTTTTTTGGTAGAGATGAGGG - Intergenic
944978552 2:205087842-205087864 TTCTGTCTGAATAGCTATGATGG - Intronic
945008277 2:205433230-205433252 TTCTTTTTAAATTGAGATATAGG + Intronic
946377431 2:219320808-219320830 TATTTTTTAAATAGAGATGGGGG + Intergenic
947177922 2:227386024-227386046 TTATTTTTTAGTAGAGATGGGGG + Intergenic
947254204 2:228143676-228143698 TTTTTTTTTTGTAGAGATGAGGG + Intronic
947423888 2:229965155-229965177 TTTTTTTTTTGTAGAGATGAGGG + Intronic
947486199 2:230551473-230551495 TTTTTTTTTAATAGACATGTGGG - Intergenic
947601369 2:231452648-231452670 TTCCTGTTGAATGAAGATGAAGG - Exonic
947707568 2:232288855-232288877 ATCTTTTTGGAAACAGATGAGGG - Intronic
948644589 2:239396146-239396168 TTTTTTTTTTGTAGAGATGAGGG + Intronic
949034233 2:241809280-241809302 GTCTTTTTGAATAGAAATTTGGG + Intronic
1168733986 20:114608-114630 ATCTTTTTAAATATAGGTGATGG - Intergenic
1169120164 20:3090983-3091005 TTTTTTTTTTGTAGAGATGAGGG + Intergenic
1169185968 20:3617644-3617666 TTCTTTTTTAGTAGGGATGGGGG - Intronic
1170154124 20:13254045-13254067 TTTTTTTTTAGTAGAGATGATGG - Intronic
1170198605 20:13717128-13717150 TTTATTTTTCATAGAGATGAGGG + Intronic
1170301631 20:14890593-14890615 TATTTTTTAAATAGAGATGGGGG - Intronic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1170434281 20:16309131-16309153 TTCTTTTTGAACAAAAATGCTGG + Intronic
1170464864 20:16613259-16613281 TTCTTTTTTAATTGAGGTCAAGG - Intergenic
1170547496 20:17447080-17447102 ATTTTTTTTAGTAGAGATGACGG - Intronic
1170788971 20:19491983-19492005 TTCTCTTTGAAGAGGGGTGAAGG - Intronic
1170846033 20:19962668-19962690 TTCTCTGTGAATTGAGGTGAAGG + Intronic
1171528777 20:25837462-25837484 TTTTTTTTTAGTAGAAATGAGGG + Intronic
1171548049 20:26018424-26018446 TTTTTTTTTAGTAGAAATGAGGG - Intergenic
1171937929 20:31293677-31293699 TTCTCCTTGAGGAGAGATGAGGG + Intergenic
1171948859 20:31403046-31403068 TTTTTTTTTAATAGAGATGGGGG - Intergenic
1172067525 20:32232292-32232314 TTTTTTTTAAATAGAGATGGGGG - Intronic
1172289309 20:33764325-33764347 TTTTGTTTAAATAGAGATGGGGG - Intronic
1172406724 20:34695313-34695335 TTTTCTTTAATTAGAGATGAGGG - Intergenic
1172521004 20:35565533-35565555 AATTTTTTTAATAGAGATGAGGG + Intergenic
1173214566 20:41068576-41068598 TTTGTTTTTAATAGAGATGGCGG + Intronic
1173355587 20:42285394-42285416 TGATTTTTGAATAGAGCAGAGGG + Intronic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1173675185 20:44828380-44828402 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1173792890 20:45839719-45839741 TTTTTTTTGTATGGAGATGAGGG - Intronic
1173996941 20:47345815-47345837 TTTTTTTTTAATAGAGATGGGGG + Intronic
1174015631 20:47485863-47485885 TTTTTTTTAAGTAGAGATGGGGG - Intergenic
1174322692 20:49754518-49754540 TTGTTTTTTAATAGAGGTGGGGG + Intergenic
1174706835 20:52664964-52664986 TACTTCTGGAATGGAGATGAGGG - Intergenic
1175076046 20:56374606-56374628 TTTTTTTTTAATAGAGATGGGGG + Intronic
1175081050 20:56420563-56420585 TTTTTTTTTTGTAGAGATGAGGG + Intronic
1175100984 20:56578653-56578675 TTTTTTTTTAATAGAAATGGAGG - Intergenic
1175377646 20:58540343-58540365 TTCTTCTTGATTAAAGATGGGGG - Intergenic
1176729375 21:10477079-10477101 TTATTTTTTTATAGAGATGGGGG + Intergenic
1176956190 21:15106841-15106863 ATATTTTTGAATAGAGGTGGTGG - Intergenic
1177634302 21:23767433-23767455 TTCTTTTTGAAATAACATGATGG - Intergenic
1177843198 21:26257320-26257342 TTCATGTTAAATAGAAATGAGGG - Intergenic
1178174503 21:30080992-30081014 TTGTGTTTTAATAGAGATGAGGG + Intergenic
1178295320 21:31405069-31405091 TTATTTCTGTGTAGAGATGAGGG - Intronic
1178419736 21:32433983-32434005 TTATTTTTTAACAGAGATGGGGG - Intronic
1178491695 21:33056620-33056642 TTTATTTTCCATAGAGATGAGGG - Intergenic
1178695026 21:34785610-34785632 CTCATTTTGAATAAAGATGTGGG + Intergenic
1178852922 21:36228153-36228175 TTTATTTTGTAGAGAGATGAAGG - Intronic
1178869647 21:36362253-36362275 TTTTTTTTAAATAGAGATGGGGG + Intronic
1178898828 21:36583057-36583079 TTCTTTGGGAGGAGAGATGATGG - Intergenic
1178999766 21:37445964-37445986 TTATTTTAAAATACAGATGAGGG - Intronic
1179535840 21:42051338-42051360 TTCTATTTGAATAAGGATGATGG - Intergenic
1180597642 22:16989206-16989228 TTCTTGTTCAAAAGAAATGAAGG + Intronic
1180644464 22:17327161-17327183 TTTTTTTTTTATAGAGATGGGGG - Intergenic
1180941636 22:19663304-19663326 TTCTCTTTGAACAGAAATAAAGG + Intergenic
1181311686 22:21948314-21948336 TTCTTTTTTGGTAGAGATGGGGG - Intronic
1182579269 22:31294676-31294698 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
1183205937 22:36418977-36418999 TTTATTTTCAGTAGAGATGATGG - Intergenic
1183299114 22:37049946-37049968 TTTTTTTAAAATAGAGATGGGGG + Intergenic
1183318785 22:37151733-37151755 TTGTATATGAAGAGAGATGAGGG + Intronic
1183416184 22:37683362-37683384 TTATTTATTTATAGAGATGAGGG - Intronic
1183612850 22:38922264-38922286 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1183906491 22:41044885-41044907 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1183960279 22:41407416-41407438 TTTTTTTTTAATTGAGATGAGGG + Intergenic
1184329462 22:43817676-43817698 TTCTTTATTAATAGACATGGTGG - Intergenic
1184720952 22:46312988-46313010 TTATTTTTTAATGGAGATGGGGG - Intronic
949714797 3:6917505-6917527 TTTTTTTTGGAAAGAGAAGATGG + Intronic
950298894 3:11856877-11856899 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
950502791 3:13375159-13375181 CTTTTTTTGAGTAGAGATGGAGG + Intronic
950845263 3:16009215-16009237 TTTTTTTTTGGTAGAGATGAGGG - Intergenic
951016702 3:17740142-17740164 TTCTTTTTTAGTAGAGACGGAGG - Intronic
951048206 3:18064773-18064795 TTCTTTTTGTAGAAAGCTGAAGG + Intronic
951524045 3:23636388-23636410 TTTTTTTTTTGTAGAGATGAGGG + Intergenic
951547432 3:23841901-23841923 TTCTATTAGGAGAGAGATGAAGG + Intronic
951616713 3:24555422-24555444 GTATTTTTGGATACAGATGATGG + Intergenic
952244590 3:31572935-31572957 ATCTATTTGAATAGATATTAAGG + Intronic
952391485 3:32884525-32884547 TTTTTTTCAAATAGAGATGGGGG - Intronic
952681373 3:36097384-36097406 TTCTTTTCAAAGAGAGATTATGG - Intergenic
952989410 3:38818623-38818645 TTTTTTTTTGATAGAGATGGAGG + Intergenic
953429866 3:42830286-42830308 TTTTTTTAAAATAGAGATGGGGG + Intronic
953990654 3:47480682-47480704 AGTTTTTTAAATAGAGATGAGGG + Intergenic
954009946 3:47627307-47627329 TTCCTCATGACTAGAGATGATGG - Intronic
954071549 3:48146520-48146542 TTTTTTTTCAGTAGAGATGGGGG + Intergenic
954189338 3:48945518-48945540 TTTTTTTTGAAGATAGATGTTGG + Intronic
954273747 3:49529203-49529225 TTTTTTTGAAATAGAGATGGGGG + Intronic
954705116 3:52475962-52475984 TGCATTTTTAATAGAGATGGGGG - Intronic
954740676 3:52747770-52747792 TTTTTTTTAAATGGAGATGGAGG - Intronic
954846702 3:53565525-53565547 TTCTTGTTAAATGGAGAGGAGGG + Intronic
955098418 3:55823058-55823080 TTCTATTTTAAAAGACATGAAGG + Intronic
955180840 3:56667761-56667783 GTCTTTTTAAATAGAGATGGGGG - Intronic
955184653 3:56703485-56703507 TTATTTTTTAGTAGAGATGGGGG - Intergenic
955275326 3:57541536-57541558 TTTTTTTTTTATAGCGATGAGGG + Intronic
955278251 3:57568591-57568613 TTTTTTTTTAATAGAGATGGAGG + Intergenic
955882307 3:63560528-63560550 ATCTTTGTGAATAAAGAGGATGG - Intronic
955934754 3:64091904-64091926 TTCTTTTTCCATAGAGACGGAGG + Intergenic
956090127 3:65657420-65657442 TTTTTTTTTGATAGAGATGGGGG - Intronic
956276771 3:67510557-67510579 TGCTTTTTTAAGACAGATGAAGG - Intronic
956660165 3:71589535-71589557 TTCTTTCTGAATAAACATGAAGG + Intergenic
956662153 3:71609880-71609902 TTATTTTTTAATAGAGATGGGGG - Intergenic
957416081 3:79907306-79907328 ATCTCTTTGATTGGAGATGATGG - Intergenic
957525991 3:81379427-81379449 TTCTTTTTGTCTAGAGAAGGAGG - Intergenic
957984067 3:87549890-87549912 TTCCTTTAAAATAGAAATGACGG - Intergenic
958531514 3:95338383-95338405 TTTTTATTGAGTAGATATGAGGG - Intergenic
958699426 3:97569065-97569087 TTCTATAAGAATAGATATGAAGG + Intronic
958731442 3:97964514-97964536 TTTTTTTTTAGTAGAGATGGGGG - Intronic
958771950 3:98435755-98435777 CTCTTTATGACTAGTGATGAGGG - Intergenic
958839469 3:99186330-99186352 TTCTATTTGAAGAGAGGAGAAGG + Intergenic
959460071 3:106614540-106614562 TTCTATTTGAATAGGAATGAGGG - Intergenic
959469586 3:106733500-106733522 TTCTTTTTGTAAGGATATGAGGG - Intergenic
960097010 3:113698603-113698625 TTTCTTTTGGATAGAGATGGGGG + Intergenic
960365984 3:116772925-116772947 TTCTTTTTGAAAAAAAATTATGG + Intronic
960795257 3:121479337-121479359 TTTTTTTTTTGTAGAGATGAGGG - Intronic
960831677 3:121856348-121856370 TTATTTTTAAATAGAGATGGAGG + Intronic
961089422 3:124097128-124097150 TTCTTTTTGAATATGGATGTGGG - Intronic
961152012 3:124647077-124647099 TTTTTATTTAATAGAGATGGGGG + Intronic
961266877 3:125650241-125650263 TTTTTTTTAAATAGAGATGTGGG - Intergenic
961848023 3:129784971-129784993 GTTTTTTTTAAAAGAGATGAGGG - Intronic
961884209 3:130085267-130085289 TTATTTTTTAATAGAGATGGGGG + Intronic
962087968 3:132211638-132211660 TGCATTTTTATTAGAGATGAGGG + Intronic
962109418 3:132428480-132428502 TTATATTTAAATAGAGATGGGGG + Intronic
962516919 3:136160699-136160721 TTTTTTTTTAATTGAGATGGAGG - Intronic
962557620 3:136571697-136571719 TTGTTTTTTGGTAGAGATGAGGG - Intronic
963027117 3:140931046-140931068 TTCTTATTGAATAAAGAGAAAGG - Intergenic
963244147 3:143044897-143044919 TCATTTTTAAGTAGAGATGAAGG + Intronic
963255092 3:143136886-143136908 TTTTTTTTTGGTAGAGATGAGGG - Intergenic
964227624 3:154426459-154426481 TTATTCTTTAACAGAGATGAAGG - Intronic
964470999 3:157055509-157055531 TTTTTTTTTAATACAGATGGGGG - Intergenic
964661271 3:159123226-159123248 GTTATTTTGAATAGAGATGTGGG - Intronic
965133157 3:164726952-164726974 TTGGTTTTGTATTGAGATGAGGG - Intergenic
965761360 3:172080447-172080469 TTTTTTTTTTCTAGAGATGAAGG + Intronic
966163105 3:176988572-176988594 CTCATTTGGCATAGAGATGAAGG - Intergenic
966179658 3:177176638-177176660 TGTGTTTTTAATAGAGATGAGGG - Intronic
966524521 3:180906577-180906599 TTTTTTTTCTGTAGAGATGAGGG + Intronic
966615078 3:181904534-181904556 TTTTTTTAAAATAGAGATGGGGG + Intergenic
966677067 3:182601162-182601184 TTCTCTTTGAATAGAAATGAAGG - Intergenic
967236467 3:187389343-187389365 TTCTATTTGAAGAATGATGATGG - Intergenic
967399269 3:189042507-189042529 TACTTTTTGAATGAAGAGGAAGG + Intronic
967516450 3:190374701-190374723 TTCTTTTTGAAAATAAATGATGG - Intronic
968336784 3:197920414-197920436 TTTTTTTTTAATTGAGATGGGGG - Intronic
968842522 4:3018081-3018103 TTTTTTTTAGATAGAGATGGGGG + Intronic
969763068 4:9204593-9204615 AAGTTTTTGAATTGAGATGATGG - Intergenic
969836907 4:9849829-9849851 TTCTGTTTCAATAGAGACGGAGG + Intronic
970924332 4:21433427-21433449 TTGTTTTTTAATAGAGATGGGGG - Intronic
970963920 4:21906018-21906040 TTTATTTGGAAAAGAGATGAGGG - Intronic
971305865 4:25480745-25480767 TTATTTTTGAATAGTGTTGTGGG - Intergenic
971329006 4:25666912-25666934 TTCTTTTTAAATAGAGACTTGGG + Intronic
971423918 4:26498080-26498102 TTCATTTTTTTTAGAGATGAGGG + Intergenic
972193170 4:36619350-36619372 TTATTTTTTTGTAGAGATGAGGG - Intergenic
972401646 4:38709846-38709868 TTTTTTTAAATTAGAGATGAAGG + Intergenic
972563128 4:40246263-40246285 CTCTTGTTGAAGAGAGATGGGGG + Exonic
973669297 4:53199254-53199276 TGCTTTCTGACTACAGATGATGG - Intronic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
973815025 4:54611563-54611585 TTCTTTTTGACTACAAAAGAAGG + Intergenic
973970420 4:56207990-56208012 TTTTTTTTTTTTAGAGATGAGGG + Intronic
974320156 4:60337114-60337136 TTCTTTCTGGCTAGAGAGGATGG + Intergenic
974442466 4:61937927-61937949 TTTTGTTTTAATAGAGAAGAGGG + Intronic
974476634 4:62389778-62389800 TTGTTTTTGTATAGTGAGGAAGG + Intergenic
974868004 4:67603775-67603797 TTCTGCTTGAGTAGAGAAGAGGG - Intronic
974945130 4:68517391-68517413 TTATTTTTAATTAGAGATGTTGG + Intergenic
974955036 4:68628661-68628683 TTATTTTTAATTAGAGATGTTGG + Intronic
975138687 4:70899048-70899070 TTATTTTTTCATAGAGATGGGGG + Intergenic
975436255 4:74355537-74355559 ATTTTTTTAAATAGAGATGGGGG + Intergenic
975493027 4:75009422-75009444 TTCCTTTTGAATATTGATTATGG + Intronic
975649885 4:76582440-76582462 TTGTTTGGGATTAGAGATGAAGG - Intronic
975711103 4:77160368-77160390 TTTTTTTTAAATAGAGATGGAGG + Intronic
976254991 4:83090558-83090580 TTTTTTTTTAATAGAGTTGGGGG - Intronic
977260260 4:94788704-94788726 TTCTCTTGGAGAAGAGATGAGGG + Intronic
977433970 4:96969310-96969332 TTCCTTTTCATTAGAGATGAAGG - Intergenic
977461864 4:97336147-97336169 TTCTTGATGAATAGATTTGATGG + Intronic
977639467 4:99340243-99340265 ATTTTTTTGGGTAGAGATGAGGG - Intronic
977713849 4:100158685-100158707 TTTTTTTACCATAGAGATGAGGG - Intergenic
977898610 4:102393843-102393865 TTCTTTTTTTGTAGAGATGCTGG - Intronic
978450054 4:108822590-108822612 TTATTTTTTAGTAGAGATGGGGG + Intronic
978515527 4:109564501-109564523 TTTTTTTGGAATAGATTTGAGGG - Intronic
979088776 4:116451210-116451232 TTTTTTTTGTATGGAGATGAGGG - Intergenic
979693718 4:123588013-123588035 TTGTATTTTAATAGAGATGGGGG + Intergenic
979839265 4:125417514-125417536 TTCTTATTTAATAGAAATTAGGG - Intronic
979879597 4:125938823-125938845 TACATTTTGAATTGAGGTGAAGG - Intergenic
979905796 4:126289987-126290009 TTCTTTCAGAATATAGAGGAGGG - Intergenic
979916221 4:126437426-126437448 TTATTTTTTAATAGAGATGGTGG + Intergenic
979981283 4:127258478-127258500 TTTTTTTTCTTTAGAGATGACGG + Intergenic
980104732 4:128576896-128576918 TTCTTTTTGAATTAGGTTGAAGG - Intergenic
981064986 4:140473872-140473894 TTTTTTTTTAGTAGAGATGGGGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981279503 4:142941002-142941024 CTCTTTTTGAAGAGAGAAGCAGG + Intergenic
981925926 4:150139043-150139065 ATTTTTTTCAATGGAGATGAGGG + Intronic
982246544 4:153357876-153357898 TTCTTTTTTAAAAAAGATGTTGG - Intronic
982896572 4:160936305-160936327 TTTTTTTTGAATTGAGATGATGG + Intergenic
983076335 4:163331751-163331773 TTCTTTTAGAAAAGTAATGATGG - Intronic
983199128 4:164841768-164841790 TGTATTTTGAGTAGAGATGAGGG + Intergenic
983596456 4:169473084-169473106 TTCTTTTTTGTTAGAGATGGTGG - Intronic
983768335 4:171516398-171516420 TTTTTTTTTTGTAGAGATGAAGG - Intergenic
984015445 4:174420499-174420521 TTATTTTTGCAAAGAGTTGAGGG - Intergenic
984150357 4:176122511-176122533 TTCCTTTTGCATATACATGAGGG + Intronic
984607034 4:181797185-181797207 TTCTTTTAGGATTGAGAGGAAGG - Intergenic
984652328 4:182283787-182283809 TCATTTTTGAATGGAGGTGATGG + Intronic
984718700 4:182950506-182950528 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
984749898 4:183262124-183262146 GTCTTTTTGAATACAAATGCAGG - Intronic
984979460 4:185265002-185265024 TTTTCTTTAAATAGAGATGGGGG + Intronic
984980638 4:185277322-185277344 TTCTTTTTTAAAGGAGAAGATGG - Intronic
985050871 4:185989568-185989590 ACCTTTTTGACTAGAGGTGATGG - Intergenic
986015775 5:3755479-3755501 TTTTTTTTTAATTGAGATAAGGG + Intergenic
986405633 5:7422211-7422233 TTTTTTTTTAATTGAGATGGGGG + Intronic
986620576 5:9668824-9668846 TTTTTTTTTAATAGTGCTGATGG - Intronic
987320913 5:16768518-16768540 TTCTTTTTAAAAAGAGAAAATGG + Intronic
987748322 5:22006189-22006211 TTTTTTTTTAATATAGATGGGGG + Intronic
988100958 5:26677301-26677323 TTGTTTTTCTATAGAGATGTAGG + Intergenic
988488787 5:31689808-31689830 TTCTTTTTGAACAGAAATTATGG - Intronic
988575407 5:32418474-32418496 TTCTTTTTCAAGAAAGATCAAGG + Intronic
988809999 5:34775556-34775578 TTCATTTTAAATAGAGATGAGGG - Intronic
989530622 5:42503796-42503818 TTTTTTTTTAATAGAACTGAAGG + Intronic
990243437 5:53838358-53838380 TTTTTTTTTAATAGAGATGGAGG - Intergenic
990399755 5:55426578-55426600 TTTTTTTTTTATAGAGATGGGGG + Intronic
990774198 5:59286936-59286958 TTCTTTTTGGATGGAGAGGGAGG + Intronic
990920416 5:60959309-60959331 TTTTTTTTGAATTGATTTGAAGG + Intronic
991089414 5:62679498-62679520 TTATTTTTAAATAGAGATAGGGG - Intergenic
991382016 5:66038390-66038412 TTCTTTTTGAAGAGGTATCAGGG - Exonic
991768497 5:70015977-70015999 TTTTTTTTAAATATAGATGGGGG + Intergenic
991847735 5:70891059-70891081 TTTTTTTTAAATATAGATGGGGG + Intergenic
992064618 5:73094698-73094720 TTCTTTTTGATCTGAGTTGATGG + Intergenic
992130596 5:73688629-73688651 TTCTTTTTGGGGAGAGAGGAGGG + Intronic
992137495 5:73762003-73762025 TTTTTTTTTTTTAGAGATGAAGG + Intronic
992549595 5:77848079-77848101 CTCTAAGTGAATAGAGATGAAGG - Intronic
992700138 5:79333815-79333837 TTTTTTTTAAATAGAGATGGGGG - Intergenic
993433988 5:87868447-87868469 TTCTTTTAGACTAGAGATTGAGG - Intergenic
993719424 5:91307879-91307901 TTTTCTTTAAATAGAGATGGGGG - Intergenic
994028524 5:95113885-95113907 TTCTTCTTGAGTAGAGAAGAGGG + Intronic
994105454 5:95943252-95943274 TTTTTTTTAAATAGAGATGGAGG - Intronic
994370244 5:98959299-98959321 TTCTTTTTTTAGAGAGATGAGGG - Intergenic
994372565 5:98983835-98983857 TTTTTTTTTAATAGAGATAGGGG - Intergenic
994992448 5:107014528-107014550 TTCTCATTAAATAGACATGATGG + Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
996317864 5:122181185-122181207 TTCTTTTTACCTAGAGAGGAAGG - Intergenic
996736847 5:126766067-126766089 TTTTTTTTTAATAGAGATGGGGG + Intergenic
997081141 5:130739693-130739715 TTTATTTTTAGTAGAGATGAAGG - Intergenic
997539194 5:134647635-134647657 TATTTTTTAAATAGAGATAAGGG + Intronic
997548989 5:134735954-134735976 TTGTTTTTAAATAGAGAAGGGGG + Intergenic
998245126 5:140494331-140494353 TTCTTTCTGAGTAAAAATGATGG - Intronic
998535570 5:142927316-142927338 TTTTTTTTGAAAAGAGATATGGG - Intronic
998786008 5:145709568-145709590 TTTTTTTTAAATACAGATCAAGG - Intronic
999413426 5:151373039-151373061 ATATTTTTTAATAGAGATGGAGG - Intergenic
999458151 5:151735159-151735181 TTTTTTTTTGGTAGAGATGAGGG - Intergenic
1000098532 5:157992693-157992715 TTTTTTTTTAATAGAGATGGCGG + Intergenic
1000307652 5:160009961-160009983 TTCATTCTGAATGGAGATTAGGG + Intronic
1000588933 5:163134907-163134929 ATCTTTTTTAATAGAGATGACGG - Intergenic
1001370813 5:171199059-171199081 TTTTTTTTAAATAGAGAAGAGGG - Intronic
1001464399 5:171950579-171950601 TTTTTTTTGAATAGAGGAAATGG - Intronic
1002063824 5:176642457-176642479 ATTCTTTTGACTAGAGATGAAGG - Intronic
1002379560 5:178816761-178816783 TTCTTTTGCAATAGGGATGTTGG - Intergenic
1002495502 5:179608753-179608775 TATTTTTTTAGTAGAGATGATGG - Intronic
1002556197 5:180043142-180043164 TTTATTTTGTGTAGAGATGAGGG - Intronic
1002630764 5:180574854-180574876 TTCTTTTTAAATTGAGAACATGG + Exonic
1002810558 6:623750-623772 TTGTTTTTGAACAGTGATGTCGG + Intronic
1003170337 6:3716755-3716777 TTATTTTTGAATAGAAAGAATGG + Intergenic
1003380588 6:5621261-5621283 TTTTTTTTTAATAGAGATGGAGG + Intronic
1004032681 6:11886474-11886496 TTCTTTTTGAATAGGTCTGTTGG - Intergenic
1004207631 6:13606994-13607016 TTTTTTTGGAATAGAGCTAAAGG + Intronic
1005006377 6:21291210-21291232 TGTATTTTTAATAGAGATGATGG + Intergenic
1005389339 6:25317572-25317594 TTTTTTTTTAATAGAGATGGGGG + Intronic
1005561854 6:27048608-27048630 TTTTTTTTTGGTAGAGATGAGGG + Intergenic
1006348136 6:33499927-33499949 TTCTTTTTTAAGAGACAGGAAGG + Intergenic
1006813963 6:36838739-36838761 TTCGTTGTTGATAGAGATGAAGG + Intronic
1006946315 6:37786778-37786800 TTCTTTTTTTGTAGAGATGGGGG - Intergenic
1007546970 6:42701701-42701723 TTTTTTTTTAGTAGAGATGAGGG + Intronic
1007609690 6:43141576-43141598 GTGTTTTTGAGTAGAGGTGAGGG + Intronic
1007758612 6:44117857-44117879 TTTTTTTTTTGTAGAGATGATGG + Intronic
1008101860 6:47400459-47400481 TTTTTGGTGAATAGATATGAAGG - Intergenic
1008104568 6:47428234-47428256 TTTTTTTTAAATAGAGATGGGGG + Intergenic
1008372750 6:50753591-50753613 TTCTTTTTCACTAGGGGTGAGGG - Intronic
1008420676 6:51295650-51295672 TTCTTTTGGAAAAGACTTGATGG - Intergenic
1008422008 6:51311998-51312020 TTTTTGTTGAATAGAGAAGCAGG - Intergenic
1008493842 6:52112932-52112954 TTTTTTTTTTCTAGAGATGAGGG - Intergenic
1008548723 6:52606313-52606335 TTCTTTTTGGATACACATAAAGG + Intergenic
1009435602 6:63614700-63614722 TTTATTTTTAGTAGAGATGAGGG + Intergenic
1009912235 6:69944731-69944753 TTCTTTTTTTATAAAGGTGATGG + Intronic
1010230994 6:73535230-73535252 TAATTTTTAAATAGAGATGGGGG - Intergenic
1010739632 6:79484728-79484750 TTTTTTTTAAAAAAAGATGAGGG - Intergenic
1011121678 6:83961216-83961238 GTCTTTGTGAATAATGATGATGG - Exonic
1011172663 6:84523254-84523276 TTCTTTGTGAATAAAACTGAAGG - Intergenic
1011267361 6:85535965-85535987 TTTTTATTGAATAGAGATCTTGG - Intronic
1011458476 6:87578117-87578139 TTATTTTTAAATAGAGATGGCGG - Intronic
1011498477 6:87962144-87962166 TTAATTTTGTGTAGAGATGAGGG - Intergenic
1011643434 6:89435163-89435185 TCCTTCTTGTATAGAGATGCTGG + Intronic
1011958949 6:93062165-93062187 TTCTTTTTGTATTGCAATGACGG + Intergenic
1012463113 6:99486088-99486110 AACATGTTGAATAGAGATGATGG - Intronic
1012466599 6:99522605-99522627 TTCTTTTTTAGTAGAGATGGGGG - Intergenic
1012468350 6:99540565-99540587 TTATTTTTTAGTAGAGATGGGGG + Intergenic
1012516409 6:100065672-100065694 TAATTTTTAAATAGAAATGAAGG + Intergenic
1012597737 6:101059606-101059628 TTCTTTATGAGTATAGCTGAAGG + Intergenic
1012645648 6:101677085-101677107 TTCTTTTTGTTTTGAAATGAGGG + Intronic
1013070635 6:106726023-106726045 TTTTTTTTTTGTAGAGATGAGGG + Intergenic
1013076676 6:106777899-106777921 TTTTTTTTTAATAGAGATGGGGG + Intergenic
1013145206 6:107383127-107383149 TTTTTTTTTAGTAGAGATGGGGG - Intronic
1013200991 6:107895847-107895869 TTTTTTTTTAATAGAGGTGCGGG - Intronic
1013495340 6:110691945-110691967 TTTTTTTAAAATAGAGATGGGGG - Intronic
1013514089 6:110869919-110869941 TCTTTTTTAAATAGAGATGGGGG + Intronic
1013866585 6:114705461-114705483 GTCTTTTAAAATAGAAATGAAGG + Intergenic
1014267500 6:119297808-119297830 TGTTTTTTAAATAGAGATGGCGG + Intronic
1015435339 6:133179926-133179948 TTCTTTTTTAAAATAGCTGAAGG + Intergenic
1015928764 6:138335532-138335554 TTTTTTTTTTGTAGAGATGATGG - Intronic
1016109413 6:140203920-140203942 ATTTTTTTGCAAAGAGATGATGG - Intergenic
1016514936 6:144883319-144883341 TTATTTATTTATAGAGATGAGGG + Intergenic
1016965223 6:149712521-149712543 TTCTTTTTGAATAGAGATGAGGG + Intronic
1017074435 6:150604414-150604436 TACTGTTTGATTTGAGATGAGGG + Intronic
1017163523 6:151388540-151388562 TTCTTTTTTAATAGAGATGTGGG + Intronic
1017781267 6:157717238-157717260 TTCATTTTTTGTAGAGATGAGGG + Intronic
1017924368 6:158898018-158898040 TTTTTTTTAAGTAGAGATGGGGG + Intronic
1018396333 6:163380606-163380628 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1018770202 6:166963669-166963691 GTTTTTTTGTATAGAGATGAAGG + Intergenic
1019800933 7:3087882-3087904 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1020047698 7:5054952-5054974 TTGTTTTTTAGTAGAGATGGGGG + Intronic
1020172380 7:5855242-5855264 TGCATTTTTAATAGAGATGGGGG + Intergenic
1020175350 7:5877644-5877666 TGCATTTTTAGTAGAGATGAGGG - Intergenic
1020290074 7:6716305-6716327 TATATTTTTAATAGAGATGAGGG - Intergenic
1020544357 7:9505123-9505145 TTATTTTTGAATAGAGTTTCTGG - Intergenic
1021394917 7:20135469-20135491 TTCCATTTCTATAGAGATGAAGG + Exonic
1021592906 7:22284022-22284044 TTCTTTGGAATTAGAGATGATGG + Intronic
1021650181 7:22825360-22825382 TTTTTTTTAAGTAGAGATGAGGG + Intergenic
1022007062 7:26275948-26275970 TTTTTTTTTTGTAGAGATGAAGG - Intergenic
1022604004 7:31790547-31790569 TTCTTTTGCAATGGAGATGACGG + Intronic
1022642202 7:32198257-32198279 TAATATTTGTATAGAGATGAGGG - Intronic
1022916712 7:34963019-34963041 TGTATTTTTAATAGAGATGAGGG - Intronic
1023339192 7:39201481-39201503 TTCTTTTTCAATAGAAATAGGGG - Intronic
1023382167 7:39619885-39619907 TTTTTTTTTAATAGAGATGAGGG + Intergenic
1023514663 7:40989592-40989614 TTTTTTTTTAGTAGAGATGGGGG - Intergenic
1023635935 7:42210313-42210335 TCATTTTTGAATAGAAGTGAGGG - Intronic
1023773312 7:43580005-43580027 TTTTATTTTAATAGAGATGGGGG + Intergenic
1025087478 7:56034903-56034925 ATGTTTTTAAATAGAGATGGGGG + Intronic
1025107448 7:56183982-56184004 TTCATTTTTTGTAGAGATGATGG - Intergenic
1025117066 7:56267372-56267394 TTAATTTTGTATAGAGATGAGGG + Intergenic
1025559875 7:62358346-62358368 TCCTTTTCGAATAGAATTGAAGG + Intergenic
1025916226 7:65868280-65868302 TTTTATTTGTATAGAGATGGGGG - Intergenic
1025938990 7:66060078-66060100 TTGTTATTGTATAGAAATGATGG - Intergenic
1025944119 7:66093140-66093162 TTATTATTGAGTAGAGATGGGGG - Exonic
1025952494 7:66156513-66156535 TTTTTTTTAAGTAGAGATGGGGG + Intergenic
1026137317 7:67674785-67674807 TTTTTTTTTTGTAGAGATGAGGG + Intergenic
1026154233 7:67813265-67813287 TTGTTTTTTTATAGAGATGGAGG + Intergenic
1026266533 7:68800369-68800391 TATTTTTTTAGTAGAGATGAGGG + Intergenic
1026620207 7:71943612-71943634 TTTATTTTTAATAGAGATGGGGG + Intronic
1026725092 7:72864653-72864675 TATATTTTTAATAGAGATGAGGG - Intergenic
1026951512 7:74350378-74350400 TTTATTTTTTATAGAGATGAGGG + Intronic
1026963672 7:74425773-74425795 TTTTCTTTTAATTGAGATGAGGG + Intergenic
1027227282 7:76251755-76251777 TTTTTTTTAAATAGAGATGGGGG - Intronic
1027408198 7:77885267-77885289 ATTTTTTTAAATAGAGATGAGGG + Intronic
1027631624 7:80613290-80613312 TTCTTTTTGCAGGGAGGTGAGGG + Intronic
1027661260 7:80990619-80990641 TATTTTTTAAATAGAGATGAGGG - Intergenic
1027943082 7:84710021-84710043 TTTATTTTTAATAGAAATGAGGG - Intergenic
1028154595 7:87415337-87415359 TTCTTTTTAAATAGTGATTTGGG + Intronic
1028208954 7:88050208-88050230 TTTTTTTTTAGTAGAGATGGAGG - Intronic
1028282945 7:88955084-88955106 TTTTTTTTAAATAGAGACAAGGG - Intronic
1028293579 7:89098760-89098782 TTCTTTTTAAATGGGGATGAAGG + Intronic
1028450099 7:90972412-90972434 TTCTTTTAGAATACAGAAAAAGG + Intronic
1028609232 7:92690557-92690579 TTCTTTTTGAACAAAGCTGGAGG - Intronic
1029081940 7:97981773-97981795 TTTTTTTTAAATAGAGATGGGGG - Intergenic
1029572154 7:101377178-101377200 TTCCTTTTAAATAGAGATGGGGG + Intronic
1029572635 7:101380466-101380488 TTATATTTTAATAGAGACGAGGG + Intronic
1029588116 7:101488098-101488120 TTTTTTTTCAGTAGAGATGGGGG - Intronic
1029633332 7:101767263-101767285 TCTTTTTAAAATAGAGATGAGGG - Intergenic
1029651146 7:101893179-101893201 TTTTTTTAAAATAGAGATGAGGG + Intronic
1029718738 7:102349002-102349024 TACATTTTTAATAGAGACGAGGG - Intergenic
1029753877 7:102560253-102560275 TACATTTTTAATAGAGACGAGGG + Intronic
1029771827 7:102659343-102659365 TACATTTTTAATAGAGACGAGGG + Intronic
1030154854 7:106444265-106444287 TAGTTTTTGAATATGGATGATGG + Intergenic
1030358998 7:108575486-108575508 TCCTTTTTGAATAGAAGCGATGG - Intergenic
1030639393 7:111986987-111987009 TTCTTATTGAATAGTGCTCATGG - Intronic
1030704861 7:112681762-112681784 TTTTTTTTTAATAGAGACGGGGG + Intergenic
1030734600 7:113031856-113031878 TTTTTTTTTTAAAGAGATGAAGG - Intergenic
1031065111 7:117096179-117096201 TTATTTTTGAAAACATATGAGGG - Intronic
1031402201 7:121338760-121338782 TTCCTCTTGAATAAAAATGATGG - Intronic
1031794421 7:126153345-126153367 TTATTATTGAATAGAGTTTATGG - Intergenic
1032037979 7:128533634-128533656 TTCTTTTTCAGTAGAAATAATGG + Intergenic
1032135142 7:129269606-129269628 TTGTTTTTTAATAGAGATGGGGG + Intronic
1032378323 7:131447524-131447546 TTTTTATTTTATAGAGATGAGGG - Intronic
1032406694 7:131661146-131661168 TTTTTTTAAAATAGAGATGGGGG + Intergenic
1032494451 7:132350329-132350351 GTATTTTTTAGTAGAGATGAGGG - Intronic
1032550573 7:132780622-132780644 TGATGTTTGAATGGAGATGATGG - Intergenic
1032973682 7:137195941-137195963 TTCTTTTTGAATTGATATACAGG - Intergenic
1033058527 7:138082372-138082394 TTTTATTTTAATAGAGATGGGGG + Intronic
1033110649 7:138571739-138571761 TTTATTTTTAATAGAGATGGGGG + Intronic
1033114235 7:138611202-138611224 TTTATTTTTAATAGAGACGAGGG - Intronic
1033117155 7:138635402-138635424 TTTTTTTTAAATAGAGATGGGGG + Intronic
1033198514 7:139348208-139348230 TTTTTTTTTAATAGAGATGGGGG + Intronic
1033419141 7:141190482-141190504 TTTTTTTTATATAGAGATGAAGG + Intronic
1034071105 7:148186589-148186611 TCCATCTTTAATAGAGATGATGG - Intronic
1034168701 7:149046007-149046029 TTTTTTTTTAATAGATATGGGGG + Intergenic
1034287048 7:149892128-149892150 TTATGTTTGAATAGAGGTGGTGG - Intergenic
1034537883 7:151737331-151737353 TTTTTTTTTAATAGAGATGGGGG - Intronic
1034600214 7:152244507-152244529 TTATTTTTTTATAGAGATGGGGG - Intronic
1034634834 7:152558960-152558982 TTTTTTTTTAGTAGAGATGGAGG + Intergenic
1034647278 7:152659343-152659365 TTCATTTTTAGTAGAGATGGGGG + Intronic
1034664074 7:152800770-152800792 TTATGTTTGAATAGAGGTGGTGG + Intronic
1035425442 7:158768857-158768879 GTTTGTTTAAATAGAGATGAGGG - Intronic
1035903348 8:3481225-3481247 TTCTTCTTGAAAAGAAATGAAGG + Intronic
1035914901 8:3608304-3608326 CTCTTTATGGATAGACATGAAGG + Intronic
1036100557 8:5778686-5778708 TTATTTTTTCATAGTGATGATGG + Intergenic
1036273225 8:7326525-7326547 AAGTTTTTGAATTGAGATGATGG - Intergenic
1036348123 8:7983827-7983849 AAGTTTTTGAATTGAGATGATGG + Intergenic
1036452643 8:8882206-8882228 TTTTTTTTTAGTAGAGATGGGGG - Intronic
1036473160 8:9068989-9069011 TTTATTTTTTATAGAGATGAGGG + Intronic
1036843412 8:12144303-12144325 AAGTTTTTGAATTGAGATGATGG + Intergenic
1036864784 8:12386618-12386640 AAGTTTTTGAATTGAGATGATGG + Intergenic
1036994635 8:13641335-13641357 TTTTTAATGAGTAGAGATGAAGG + Intergenic
1037843770 8:22264375-22264397 TTTTTTTTTTGTAGAGATGAGGG - Intergenic
1038842399 8:31197232-31197254 TTCTTTTTTTATAGAGATAGGGG + Intergenic
1038930658 8:32190001-32190023 TCAGTTTTGAATAGAGAAGAAGG - Intronic
1039055922 8:33536477-33536499 TTATTTTTTAGTAGAGATGGGGG - Intergenic
1039200433 8:35085517-35085539 TTATTTTTTTGTAGAGATGAGGG + Intergenic
1039664769 8:39513004-39513026 TTTATTTTTAGTAGAGATGAGGG - Intergenic
1039825080 8:41166158-41166180 TTTTTTTTTTTTAGAGATGAGGG + Intergenic
1039855079 8:41404877-41404899 TTTTTTTTTTATAGAGATGGGGG - Intergenic
1039904513 8:41776252-41776274 TTTTTTCTGAATAGAGAGAATGG - Intronic
1039937502 8:42058692-42058714 TTTTTTTTTGATAGAGATGGGGG - Intergenic
1040455083 8:47589344-47589366 TGCATTTTTAATAGAGATGGGGG - Intronic
1040585438 8:48736186-48736208 ATCTTTTGGAAGTGAGATGAGGG - Intergenic
1040628912 8:49185677-49185699 TTAAATTTGACTAGAGATGATGG - Intergenic
1040849090 8:51880008-51880030 TTTTTTTTGGTTAGAGATGATGG - Intronic
1041230218 8:55742881-55742903 TAGTTTTTGCAAAGAGATGAAGG - Intronic
1041303778 8:56438992-56439014 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1041621287 8:59972612-59972634 TTTTTTTTTAATAGAATTGATGG - Intergenic
1041722513 8:60989041-60989063 TTTTTTTTTAGTAGAGATGGGGG + Intergenic
1042167803 8:65963090-65963112 TGTATTTTGAATAGAGATGGGGG - Intergenic
1042345543 8:67723337-67723359 TTTTATTTAAATAGAGACGAGGG + Intronic
1042511359 8:69615743-69615765 TTCCTATGGGATAGAGATGAAGG - Intronic
1042628691 8:70791299-70791321 TTTTTTTTTAAGTGAGATGAGGG - Intergenic
1042827844 8:72996251-72996273 TTCTGTATGAATACATATGAAGG - Intergenic
1043326045 8:79052833-79052855 TTCTTTTGGAGAAGGGATGAGGG - Intergenic
1043451762 8:80374861-80374883 TTCTTTTTTGGTAGAGATGGGGG + Intergenic
1043768193 8:84163844-84163866 GTATTTTTTAATAGAGATGGGGG + Intergenic
1045028740 8:98115561-98115583 TTTTTTTTAAATAGAGATGGGGG + Intronic
1045372023 8:101533942-101533964 TTCCTTTAGAATAGAAGTGATGG - Intronic
1045403729 8:101844365-101844387 TTTTTTTTTCTTAGAGATGAGGG + Intronic
1045408179 8:101888588-101888610 TTTTTTTTTAATAGAGATGAGGG + Intronic
1045442022 8:102223518-102223540 GTATTTTTTAATAGAGATGGGGG - Intronic
1045770389 8:105731222-105731244 TTCTTTTTGAAAAAAAATAAGGG - Intronic
1046270592 8:111891322-111891344 TTTTTTTTTAATAGAGATGAAGG + Intergenic
1046539597 8:115562449-115562471 TTATTTTGGAAAAGAGAAGAGGG - Intronic
1046725381 8:117668019-117668041 TTTATTTTTAGTAGAGATGAGGG - Intergenic
1046916353 8:119681873-119681895 TTCCCTTTGGATAGAGGTGATGG + Intergenic
1047223961 8:122941055-122941077 TTTTTTTTTAATAGAGATAGGGG - Intronic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1048006042 8:130419961-130419983 TTTTTTTTTAATAGAGATGGGGG + Intronic
1048110963 8:131468232-131468254 TTCCTTTTGCTTAGAGTTGAAGG - Intergenic
1048433441 8:134392239-134392261 TTTTATTTTCATAGAGATGAAGG + Intergenic
1048616359 8:136079863-136079885 TTCATTTTGAATTGTGTTGAAGG + Intergenic
1049924175 9:392879-392901 TTCTTTATGGAGAGACATGATGG - Intronic
1050291673 9:4161856-4161878 TTTTTTTTCAGTAGAGATGGGGG + Intronic
1050454900 9:5824699-5824721 TTCTTTTTAAAAAGAGAAGGGGG - Intronic
1051020759 9:12539671-12539693 TTTTTTTTGCATAGAGATTTTGG + Intergenic
1051980004 9:23002260-23002282 CCTTTTTTGAATCGAGATGAAGG + Intergenic
1052264920 9:26561079-26561101 TTCTTCCTGAATTGAGAAGAAGG + Intergenic
1052352165 9:27469138-27469160 TTCTTTTTTTGTAGAGATGGGGG + Intronic
1052383448 9:27796944-27796966 TTCTACGTGAATAGAGATGGGGG + Intergenic
1052573266 9:30257183-30257205 TTATTGCTGAATAGAGATAAAGG + Intergenic
1052808327 9:33033521-33033543 TTTTTTTTTAATAGAGATGGGGG - Intronic
1053348246 9:37394041-37394063 TTTTTTTTAATTAGAGATGGGGG + Intergenic
1055018330 9:71643165-71643187 TTTATTTTGAGTAGAGACGAGGG - Intergenic
1055028011 9:71743044-71743066 TTAATTTTAAATAGAGATGGGGG - Intronic
1055145819 9:72933578-72933600 TTTTTTTTGTTTTGAGATGAGGG - Intronic
1055267377 9:74511590-74511612 TTCTTTTGCTATATAGATGAGGG - Intronic
1055457516 9:76486901-76486923 TTTGTTTTAAGTAGAGATGAGGG - Intronic
1055565032 9:77559691-77559713 TTCTTTGTGAATAAACCTGAAGG - Intronic
1055992810 9:82125825-82125847 TTCTTTATTAAAAGAGATAAGGG - Intergenic
1056244900 9:84684816-84684838 TTCTTTTTTAATTGAATTGATGG + Intronic
1056519731 9:87389062-87389084 CTCTTTTTAAATAGAGATTGGGG - Intergenic
1056596706 9:88013670-88013692 TTCTTTTTTAGTAGAGATGGTGG - Intergenic
1057032838 9:91790325-91790347 TTTTTTTTCAGTAGAGATGGGGG - Intronic
1057072701 9:92114098-92114120 TTTTTTTTTAATAGAGACGGGGG - Intronic
1057562857 9:96141542-96141564 TCATCTTTGAAGAGAGATGAAGG + Intergenic
1058297470 9:103327018-103327040 TTCTCTGTAAAGAGAGATGAGGG + Intergenic
1058365964 9:104208713-104208735 TGCATTTTTAATAGAGATGGGGG + Intergenic
1058955753 9:109946513-109946535 TTTTTTTTTAGTAGAGATGGGGG - Intronic
1059193065 9:112345331-112345353 TTTTTTTTTTTTAGAGATGAGGG - Intergenic
1059250864 9:112886899-112886921 TTTTTTTTGTTTAGAGATGGGGG + Intronic
1060233540 9:121843161-121843183 TTTTTTTTAAATAAAGATGGGGG - Intronic
1060242899 9:121919837-121919859 TTTTTTTTTTTTAGAGATGAGGG - Intronic
1060293719 9:122328858-122328880 TTTTTTTTAATAAGAGATGAGGG + Intergenic
1060612309 9:124978829-124978851 TTCTTTATGAACAGGTATGAAGG + Intronic
1060644445 9:125265893-125265915 TTCTTTTTTAATAGAGACAGGGG - Intronic
1060713914 9:125902082-125902104 TTTTTTTTTAAGAGAAATGATGG + Intronic
1060830431 9:126710991-126711013 TATTTTTTGGAGAGAGATGAAGG + Intergenic
1060838921 9:126779129-126779151 TACTTTTTTAGTAGAGATGGGGG + Intergenic
1060863859 9:126979380-126979402 TTGTTTTTGATTAGAAATAATGG - Intronic
1060948802 9:127587440-127587462 TTAATTTTTAATAGAGATGGGGG + Intergenic
1061343978 9:130007059-130007081 TTTTTTTTTTGTAGAGATGAGGG - Intronic
1061436935 9:130569723-130569745 ATGTTTTTTCATAGAGATGAGGG - Intergenic
1061635329 9:131904521-131904543 TTTTTTTTAAATAGAGATCGGGG + Intronic
1203584886 Un_KI270746v1:56997-57019 TTATTTTTTTATAGAGATGGGGG - Intergenic
1185691869 X:2162101-2162123 TACATTTTGAATAGAGAACAAGG + Intergenic
1185827735 X:3268562-3268584 TTCGAACTGAATAGAGATGATGG - Intergenic
1185973484 X:4691557-4691579 TTTTTTTTTAATAGACATCAAGG + Intergenic
1186432012 X:9513054-9513076 TGCATTTTGAATACAAATGAAGG + Intronic
1186468782 X:9805064-9805086 TTTTTTTTTAGTAGACATGAGGG - Intronic
1186990217 X:15059194-15059216 TTCTTTTTGATAAAAGAGGATGG - Intergenic
1187327654 X:18306839-18306861 TTTTATTTTTATAGAGATGAGGG + Intronic
1187830290 X:23374250-23374272 TTCTTGTTGAAAAGGGAGGAGGG - Intronic
1188226691 X:27608477-27608499 TTTCTTTTGAATACACATGATGG + Intronic
1188482120 X:30646915-30646937 TTTTTTTTGGGTAGAGATGAGGG - Intergenic
1188816473 X:34721280-34721302 ATCTTTTTGAATTGTGATGATGG - Intergenic
1189512110 X:41673289-41673311 TTATGTTTAAAAAGAGATGAGGG + Intronic
1189597178 X:42581161-42581183 TCCTTTTTCAATGGAAATGAAGG + Intergenic
1189602130 X:42638339-42638361 TTGTTTTTGAGGAGAGAAGAGGG + Intergenic
1189608209 X:42702796-42702818 TTTTTTTAGAATAGAAATGAAGG - Intergenic
1189693891 X:43644007-43644029 TTTTTTTTTAAAAGAGATAAGGG - Intergenic
1190021566 X:46882923-46882945 TGAATTTTTAATAGAGATGATGG + Intergenic
1190188519 X:48256471-48256493 TTTTTTTTTTGTAGAGATGAGGG + Intronic
1190690847 X:52911819-52911841 TTCTTTTAGACTATAGAGGAGGG + Intergenic
1190695136 X:52943973-52943995 TTCTTTTAGACTATAGAGGAGGG - Intronic
1190820712 X:53969059-53969081 TGCATTTTTAGTAGAGATGAGGG - Intronic
1190886369 X:54534051-54534073 TTTTTTTTCAATAGAGATGAGGG + Intronic
1190901925 X:54683713-54683735 TTATTTTTGAAAAGAGGTAAAGG - Intergenic
1190990926 X:55549443-55549465 TTCATTTTGAACACAGAGGATGG - Intergenic
1191636759 X:63386376-63386398 TTATTTCTGAATAGGAATGAAGG - Intergenic
1191675586 X:63789075-63789097 TGTTTATTGAATAGAAATGAGGG - Intergenic
1191826405 X:65370072-65370094 TTCTTTTTCAATATAGACGAGGG - Intronic
1191937274 X:66439256-66439278 TTTGTTTTTAATAGAGATGGAGG + Intergenic
1192474260 X:71426158-71426180 TTTTTTGTAAATAGAGATGGGGG + Intronic
1193110829 X:77728203-77728225 TTTTTTTTAAATAAAGATGGGGG - Intronic
1193260722 X:79403745-79403767 TTCTGCTTGATGAGAGATGAGGG + Intergenic
1194536228 X:95108307-95108329 TTCTGTCTGAATAGAACTGAGGG + Intergenic
1194943394 X:100040150-100040172 TTTTTTTTTTTTAGAGATGAGGG - Intergenic
1194955181 X:100170758-100170780 TACTTTTTGAATAGAGATGTAGG + Intergenic
1194971144 X:100345634-100345656 TGCTTTTTGAATAGAAATTATGG + Intronic
1195349586 X:103983993-103984015 TTCTTGTTGAATACATATGGGGG + Intergenic
1195357857 X:104054846-104054868 TTCTTGTTGAATACATATGGGGG - Intergenic
1195682393 X:107558452-107558474 ATCTTTTTGTATAGAGATGGGGG - Intronic
1195867913 X:109453261-109453283 TTCTTTTTGAAAAGAGTGGTGGG + Intronic
1195898969 X:109777796-109777818 TTCTTTTAGAATAGAAAGGATGG + Intergenic
1196947260 X:120840149-120840171 TCTTTTTTCAATACAGATGAAGG - Intergenic
1197166015 X:123378581-123378603 TTGTATTTTAGTAGAGATGAGGG + Intronic
1197167480 X:123393812-123393834 CTGTTTATGAATAGAAATGATGG + Intronic
1197602677 X:128548471-128548493 TTCTGCTTGAGTAGAGAAGAGGG - Intergenic
1198056298 X:132998831-132998853 TCCTTTTGGAATAGAGCAGAAGG + Intergenic
1198122430 X:133607438-133607460 TTTCTTTTTAATAGAGATGGGGG + Intronic
1198228392 X:134667746-134667768 TTTTTTTTTTATAGAGATGGGGG - Intronic
1198578466 X:138036788-138036810 TTCTTTTTGAGGAGAGGTGAGGG + Intergenic
1199047358 X:143191194-143191216 TTCTTTTTGAAAGATGATGAAGG - Intergenic
1199132674 X:144210783-144210805 TTCTTTTTGCATGGAGAGAAAGG + Intergenic
1199360376 X:146910746-146910768 TTCTTAGTTAATAGTGATGATGG - Intergenic
1199447836 X:147946303-147946325 TTCTCTTTGAATAGAAAATAAGG + Intronic
1201704445 Y:16920779-16920801 TTTTTTTTAAATAGACATCAAGG - Intergenic
1201988560 Y:19996529-19996551 ATTTTTGTGAATAAAGATGATGG + Intergenic
1202016545 Y:20412661-20412683 TTCTTTTTGAATTGTGAGGCTGG - Intergenic