ID: 1016965744

View in Genome Browser
Species Human (GRCh38)
Location 6:149717698-149717720
Sequence CAGCCAAGTCAGGCCCGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016965738_1016965744 10 Left 1016965738 6:149717665-149717687 CCCAGGGCAGGGCTCAGCTCGGG 0: 1
1: 0
2: 2
3: 33
4: 331
Right 1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 206
1016965740_1016965744 9 Left 1016965740 6:149717666-149717688 CCAGGGCAGGGCTCAGCTCGGGT 0: 1
1: 0
2: 4
3: 24
4: 260
Right 1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 206
1016965734_1016965744 20 Left 1016965734 6:149717655-149717677 CCCTCGCTTCCCCAGGGCAGGGC 0: 1
1: 0
2: 2
3: 34
4: 375
Right 1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 206
1016965736_1016965744 11 Left 1016965736 6:149717664-149717686 CCCCAGGGCAGGGCTCAGCTCGG 0: 1
1: 0
2: 2
3: 29
4: 384
Right 1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 206
1016965731_1016965744 24 Left 1016965731 6:149717651-149717673 CCAACCCTCGCTTCCCCAGGGCA 0: 1
1: 0
2: 2
3: 45
4: 322
Right 1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 206
1016965735_1016965744 19 Left 1016965735 6:149717656-149717678 CCTCGCTTCCCCAGGGCAGGGCT 0: 1
1: 0
2: 3
3: 40
4: 410
Right 1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016965744 Original CRISPR CAGCCAAGTCAGGCCCGGAG CGG Intronic
900381579 1:2386845-2386867 CAGCCAAGCCAGGCCCAGCACGG - Intronic
900430395 1:2598638-2598660 CAGCCAGGTGAGGCCCAGGGAGG - Exonic
900947196 1:5837655-5837677 CTGGCAATTCAGGCCGGGAGCGG + Intergenic
901325884 1:8364887-8364909 CAGCCAAGGCTGGGCCGGTGGGG + Intronic
902444893 1:16456313-16456335 CATCCAAATCAGGCCAGGCGCGG - Intronic
903173947 1:21569750-21569772 CAGCTAGGCCAGGCCTGGAGAGG - Intronic
903340664 1:22652408-22652430 ACGCCAAGTTAGGGCCGGAGAGG - Intergenic
905478490 1:38245355-38245377 CAGGCAGGTAAGGCCTGGAGTGG + Intergenic
905482882 1:38273664-38273686 CCACCAGGTCAGGCCTGGAGCGG + Intergenic
905906690 1:41623190-41623212 CAGCCGAGTCAGGCAGGAAGTGG + Intronic
912453856 1:109784864-109784886 CAGCCAAGTCATATCCAGAGGGG - Intergenic
912506080 1:110157282-110157304 CAGTCAGGTCAGGCCAGGTGTGG + Intronic
917012187 1:170487501-170487523 CAGCCAAGTCAGAGGAGGAGAGG - Intergenic
918551182 1:185744281-185744303 CAGTCAAGTCAGGCCAGGCATGG - Intronic
921706129 1:218324114-218324136 CAGCACAGTCAGGCACGGAGGGG - Intronic
1065813744 10:29465579-29465601 CAGCCAGGTAAGGCCTGCAGGGG - Exonic
1065957915 10:30709447-30709469 CAGCCAGGTAAGGCCTGCAGGGG + Intergenic
1065970126 10:30799400-30799422 CAGAGAAGTCAGACCAGGAGGGG + Intergenic
1067047074 10:42990861-42990883 CAGTCAAGTCAGGGCTGGTGGGG - Intergenic
1067814028 10:49457959-49457981 CAGACAAGAGAGGCCTGGAGTGG + Exonic
1068956944 10:62826977-62826999 AAGCCAAGTGAGCCCCAGAGGGG + Intronic
1071093832 10:81950408-81950430 GAGGAAAGTCAGGCCCAGAGAGG + Intronic
1071931609 10:90478067-90478089 TAGCTAAGTCAGGCCAGGTGCGG + Intergenic
1072460732 10:95616438-95616460 GCACCAAGTCAGGCCCAGAGGGG - Intronic
1073079962 10:100853497-100853519 CAGCCAACTGAGGCCCAGAGAGG + Intergenic
1073388746 10:103153396-103153418 CAGAGAACTCAGGCCCTGAGAGG + Intronic
1074355724 10:112781496-112781518 GAGCCAAGACAGCCCCGTAGAGG - Intronic
1075522352 10:123150524-123150546 CGGCCAAGCCAGGCCCTCAGAGG + Exonic
1076357516 10:129864020-129864042 AAGCCCAGTCAGCCCCAGAGTGG + Intronic
1077164333 11:1128535-1128557 CAGCCAGGACAGTCCCCGAGTGG + Intergenic
1079096261 11:17512324-17512346 GAGGCAAATCAGGCCCAGAGAGG - Intronic
1079297983 11:19251597-19251619 CAGCCATCTTAGGCCAGGAGTGG - Intergenic
1081568642 11:44276081-44276103 CAGCCATGTCTGGCCCAGTGGGG + Intronic
1082916421 11:58443308-58443330 CAGCCAAGTTTGGCCAGGCGCGG + Intergenic
1083468964 11:62869187-62869209 TAGCCAATTCAGGCCAGGCGTGG - Intronic
1084590374 11:70086643-70086665 CAGCCAAGAAAGGGCCAGAGCGG + Intronic
1085028707 11:73256841-73256863 AAGCCAAGTTAGGCCGGGCGCGG - Intergenic
1085404067 11:76251339-76251361 AAGTCAAGTCAGGCATGGAGCGG - Intergenic
1088115457 11:106306883-106306905 CAGCCAAGTTGGACCCAGAGAGG - Intergenic
1088486614 11:110346903-110346925 AAGCCAACTCAGGCCAGGTGCGG - Intergenic
1091855037 12:3732600-3732622 CAGACAATTCTGGCCAGGAGTGG - Intronic
1093958913 12:25251294-25251316 CCGCCAATTCTGACCCGGAGCGG + Intergenic
1094178133 12:27563149-27563171 CAGACAATTCAGGCCAGGTGTGG + Intronic
1095950676 12:47780233-47780255 CAGCAAAGTCAGCCCGGTAGCGG - Exonic
1096336198 12:50758474-50758496 CAGCCAAGTCCGGCCCAGGCTGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097362675 12:58674987-58675009 AAGCCAAGACAGGCCGGGCGAGG - Intronic
1101427351 12:104598996-104599018 CAGCTAAGGGAGGCGCGGAGGGG + Intronic
1103060654 12:117855759-117855781 GAGCAAAGTGAGGCCCAGAGAGG - Intronic
1104949524 12:132432952-132432974 CTGCCAAGTGGGGCCCCGAGAGG + Intergenic
1107964832 13:45588999-45589021 CAGCCACCCCAGGCCTGGAGCGG - Intronic
1113897708 13:113776373-113776395 CCGCCGAGTCAGCCCCTGAGTGG - Intronic
1115020959 14:28681404-28681426 CAGCCATATCAGGTCAGGAGTGG - Intergenic
1117149794 14:52873867-52873889 CTTCCAACTGAGGCCCGGAGGGG + Intronic
1118475447 14:66112060-66112082 CAGCCAAGTCAGGCAGGGCTTGG + Intergenic
1119163714 14:72474998-72475020 CAGCTAAGCCAGACCTGGAGTGG + Intronic
1119527565 14:75334280-75334302 CTGCGGAGTCAGGCGCGGAGGGG - Intergenic
1121578907 14:95011653-95011675 CATCCGAATCAGGCCCGGGGAGG - Intergenic
1123112321 14:105878786-105878808 CAGCACAGTGAAGCCCGGAGCGG - Intergenic
1125518538 15:40336035-40336057 CAGCCATGGCAGGACCAGAGAGG + Intronic
1125611823 15:40976549-40976571 TTGCCAAGTCAGACCCAGAGGGG + Intergenic
1128443092 15:67731680-67731702 GAGCCAACTCAGGCTCAGAGAGG + Intronic
1129918287 15:79294302-79294324 CACCCACGTCTGGCCAGGAGAGG + Exonic
1130442016 15:83963857-83963879 CAGGCAAACCAGGCCTGGAGTGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132458252 16:36124-36146 CAGGCAAGTCAGACCCAGAGAGG + Intergenic
1132660974 16:1061452-1061474 CAGCAGAGCCAGGCCCTGAGGGG - Intergenic
1132676933 16:1124786-1124808 CTGCCAATTCAGGCTAGGAGTGG - Intergenic
1132710669 16:1265714-1265736 CAGCCAGGTGAGGCCAGGAGAGG + Intergenic
1132845231 16:1998141-1998163 CAGCCAGGTAAGGCCTGGTGAGG - Exonic
1133026880 16:2992432-2992454 CAGCCAGGTCGGGGCCGAAGGGG + Intergenic
1133729170 16:8565450-8565472 CAGCCAGGTCTGGACCTGAGGGG + Intergenic
1134251619 16:12578196-12578218 CAACCATGACAGGCCAGGAGAGG + Intergenic
1134421505 16:14095295-14095317 CTCCCAAGTCAGGCCCCAAGTGG - Intronic
1134756676 16:16673367-16673389 GAGCAAAGTGAGGCCCAGAGAGG + Intergenic
1134788175 16:16963839-16963861 CAGTCAAATCTGGCCCTGAGTGG - Intergenic
1134989392 16:18685796-18685818 GAGCAAAGTGAGGCCCAGAGAGG - Intergenic
1136683940 16:31983327-31983349 CAGCCAAGCCAGGCCCCCAGAGG - Intergenic
1136784567 16:32926879-32926901 CAGCCAAGCCAGGCCCCCAGAGG - Intergenic
1136885216 16:33926927-33926949 CAGCCAAGCCAGGCCCCCAGAGG + Intergenic
1137478610 16:48832221-48832243 GAGGCAACTCAGGCCCAGAGAGG + Intergenic
1137988790 16:53131490-53131512 CAGCCATGACAGGCGCGGGGCGG - Intronic
1138528388 16:57621657-57621679 GAGCCAAATGAGGCCCAGAGAGG - Intronic
1141128544 16:81418497-81418519 CAACAAAATCAGGCCCGGCGCGG - Intergenic
1141134459 16:81456623-81456645 GAGCAAACTGAGGCCCGGAGAGG + Intronic
1142129871 16:88427660-88427682 CAGCCAAGGCAGGCCAGGGACGG + Exonic
1203087226 16_KI270728v1_random:1190885-1190907 CAGCCAAGCCAGGCCCCCAGAGG - Intergenic
1142769124 17:2084096-2084118 GAGGCAAGTGAGGCCCAGAGAGG - Intronic
1144945966 17:18969592-18969614 CAGCCAGGGCAGTCCCTGAGGGG - Exonic
1145861204 17:28211881-28211903 CTGCCAAGTCAGGCACGGTAGGG - Intergenic
1147144864 17:38479030-38479052 CAGCCAAGAGAGGCCCCCAGAGG - Intronic
1147348164 17:39818568-39818590 TAGCCTACTCAGGCCAGGAGTGG + Intronic
1148565244 17:48628735-48628757 CTGCAAAGTCAGGGCAGGAGAGG - Intronic
1148777435 17:50103576-50103598 GAGCAAACTCAGGCCCAGAGAGG + Intronic
1149486447 17:57046351-57046373 CATCCCAGTCGGGCCCGGGGCGG - Intergenic
1149987744 17:61360549-61360571 AAGCCAAGTAATGCCAGGAGTGG - Intronic
1151018274 17:70582889-70582911 CAGCCAGGTGATGCCCAGAGGGG - Intergenic
1151401039 17:73856372-73856394 CAGCCCGGTCATGCCCGGGGGGG - Intergenic
1151696694 17:75721590-75721612 CAGCCGAGGCTGGCCGGGAGAGG + Exonic
1152016986 17:77757190-77757212 CTGCCAGGTGAGGCCAGGAGAGG + Intergenic
1152368474 17:79870762-79870784 CAGCCAAGCCAGCACCGCAGCGG + Intergenic
1152756547 17:82089424-82089446 CACCCACCTCAGGCTCGGAGAGG + Intronic
1152930931 17:83109549-83109571 AGGCCAGGCCAGGCCCGGAGAGG - Intergenic
1153726292 18:7959038-7959060 AAGGCAACTCAGGCCCAGAGAGG - Intronic
1153968549 18:10203781-10203803 CATCAAAGTCAGGCCTGCAGTGG + Intergenic
1157184513 18:45527047-45527069 CAGAAAAGTAAGGCCCAGAGAGG + Intronic
1160663848 19:313716-313738 CAGCCAACTCAGCCCCTGACAGG + Intronic
1162070003 19:8147718-8147740 CAGCCAAGGCAAGACGGGAGTGG + Intronic
1162343672 19:10107268-10107290 GAGCGAACTCAGGCCCAGAGAGG - Intronic
1163708712 19:18832659-18832681 CAGCCAGGTCGCGGCCGGAGCGG - Intronic
1163823116 19:19507597-19507619 CAGCCAGGCCAGGCTGGGAGAGG - Exonic
1163862567 19:19749893-19749915 CAGCCAGGTCAGGGTGGGAGAGG - Intergenic
1165742293 19:38211376-38211398 CAGCCACGGCAGGCACGGGGCGG + Intronic
1166193690 19:41193159-41193181 CAACGAAGTCAGGCGCGGGGCGG - Exonic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
925156559 2:1652606-1652628 CAGCCACGAGAGGCCAGGAGAGG + Intronic
928952085 2:36822186-36822208 CAGCCAAGACTGTCCCAGAGGGG + Intergenic
929180824 2:39036863-39036885 CAGCCTGGTCAGGCCGGGCGCGG - Intronic
932495096 2:72142229-72142251 AGGCCAAGTCAGGCCCAGGGTGG + Intronic
932621088 2:73265309-73265331 CAGCCATAGCAGGCCCGGGGCGG + Exonic
936101181 2:109581147-109581169 CAGTAAAGTTAGGCCGGGAGAGG + Intronic
941680459 2:168393044-168393066 AAGCCAAGTCAGGCCAAGCGTGG + Intergenic
942431670 2:175918154-175918176 AGGCCAAGTCTGGCCCAGAGTGG - Intergenic
945255830 2:207802264-207802286 CAACCAAGTGAGGCCGGGCGTGG - Intergenic
947869996 2:233429749-233429771 CGGCAAAGGCAGGCCCGGAGGGG - Intronic
948169788 2:235891809-235891831 CTGCCAGGTATGGCCCGGAGGGG - Intronic
948537605 2:238657857-238657879 CAGCCCACACAGGCCGGGAGAGG + Intergenic
948926446 2:241101760-241101782 CAGTCAACTCAGGCCGGGCGCGG + Intronic
1168853172 20:990289-990311 CAGCCAAGTGAAGGCAGGAGGGG + Intronic
1171330873 20:24337810-24337832 CAGCCAATTCAGGCCCTGGCTGG + Intergenic
1172182561 20:33012562-33012584 CACCCAAGTCCTGCCCGAAGCGG + Intronic
1173397617 20:42694892-42694914 TATCCTAGTCAGGCCCTGAGAGG - Intronic
1173801392 20:45896800-45896822 CATCCAAGTCAGTCCTAGAGAGG + Intronic
1173884424 20:46445145-46445167 AAGGCAAGTCAGGCATGGAGTGG + Intergenic
1175388145 20:58610420-58610442 CAGCCAGGTCAGGCATGGAGAGG - Intergenic
1176214910 20:63943408-63943430 CAGCAAAGTCTGGCCAGGACAGG + Intronic
1177037038 21:16057021-16057043 CATCCAACTCTGGCCTGGAGTGG - Intergenic
1177313317 21:19425001-19425023 CAGGCAAATAAGGCCTGGAGTGG + Intergenic
1179962153 21:44773704-44773726 CAGCCAAGTGAGCCCAGGAATGG + Intronic
1182146536 22:28000339-28000361 CAGCCAAGACAGGTCCTGTGGGG + Intronic
1183281833 22:36936375-36936397 CAGCAAAGTGAGGCCCAGAGAGG - Intronic
1184343571 22:43899487-43899509 CACCCAAGACAGGCAAGGAGAGG - Intergenic
1185207219 22:49546962-49546984 CAGCCTTGTCAGACCCTGAGCGG + Intronic
950583102 3:13875793-13875815 TAGGCCAGTCATGCCCGGAGTGG - Intronic
950718786 3:14867968-14867990 CAGCCAAGTCATGATAGGAGAGG + Intronic
954395629 3:50291954-50291976 CAGGCAACTGAGGCCCGGAGGGG + Intronic
954633792 3:52060618-52060640 CATCTAAGCCAGGCCAGGAGAGG + Intergenic
968392547 4:205266-205288 CAGCCAAGCCAGGGCCGGGGCGG - Intergenic
968622146 4:1608591-1608613 CAGCAAAGTCAGGTCAGCAGTGG + Intergenic
968643037 4:1724260-1724282 CAGCCAAGGCCGGCCGGGCGTGG - Intronic
968728382 4:2258708-2258730 CAGCCAGGTCAGCCCATGAGGGG + Intronic
969339683 4:6532305-6532327 CAGCAAAGTCAGAGCTGGAGAGG + Intronic
969352615 4:6606438-6606460 CTGCCAGGTTAGGCCAGGAGAGG + Intronic
972396503 4:38663689-38663711 CAGCCGTGTGACGCCCGGAGCGG + Intergenic
974894866 4:67926779-67926801 CAGCTTGGTCAGGCACGGAGGGG + Intronic
980481733 4:133396304-133396326 AAGCCAAGTAAGTCCCAGAGAGG + Intergenic
983631052 4:169849704-169849726 AAAACAAGTCAGGCCCTGAGTGG + Intergenic
984255193 4:177382076-177382098 CAGCCCAGTCAGGCATGGAAGGG - Intergenic
986075575 5:4334283-4334305 CTACCAAGACAGGCCTGGAGAGG + Intergenic
991557769 5:67914759-67914781 CAGCCAAGTGAGGCCCAGGAAGG + Intergenic
991966259 5:72094439-72094461 AAGCCATGTCAGGCCGGGCGTGG + Intergenic
992093569 5:73340159-73340181 CAGCCAAGGGAGGCTGGGAGAGG - Intergenic
993073892 5:83201751-83201773 CTGCCACGTCAGGCCAGGTGCGG + Intronic
997674975 5:135706175-135706197 CAGCCCAGTCAGGCCCTGTTTGG - Intergenic
997817806 5:137035241-137035263 CAGCCGTATCAGGACCGGAGTGG + Intronic
998491665 5:142551979-142552001 GAGCCAAATCAGCTCCGGAGGGG - Intergenic
999131651 5:149288321-149288343 GAGCCAAGTGAGGCTCAGAGAGG - Intronic
1001275738 5:170349910-170349932 CAAATAAGTCAGGCCCAGAGAGG - Intergenic
1002085781 5:176774617-176774639 CAGCCGATCCAGGCCCAGAGGGG - Intergenic
1002789496 6:426946-426968 CTGCCAAGGCAGGCCTGGGGTGG + Intergenic
1003279287 6:4677836-4677858 CAGCCATGTCACGCCCTGCGAGG + Intergenic
1006066874 6:31468386-31468408 CAGCCAAGGCAGGCCTGTTGTGG - Intergenic
1006830560 6:36965364-36965386 CACCCAAGTCAGGCCAGGGCTGG + Intergenic
1007948251 6:45845150-45845172 CAGACAAGTAAGGCCCAGAAAGG - Intergenic
1013082092 6:106821836-106821858 GAGGCAAGTCAGGCCAGAAGGGG + Intergenic
1014376464 6:120680979-120681001 CTACAAAGTCAGGCCCGGCGGGG - Intergenic
1016965744 6:149717698-149717720 CAGCCAAGTCAGGCCCGGAGCGG + Intronic
1019634968 7:2070581-2070603 CAGCCCAGGCAGGCGCAGAGCGG + Intronic
1019770635 7:2881983-2882005 CAGCAAACTGAGGCACGGAGTGG - Intergenic
1020111524 7:5450763-5450785 CAGCCAGACCAGGCCCAGAGAGG - Intronic
1020689161 7:11333179-11333201 TAGGCAAGTCAGGCCCAGTGAGG - Intergenic
1026000652 7:66557470-66557492 CAGCCCAGGCAGTCCCGGAGTGG + Intergenic
1026849547 7:73716415-73716437 CAGCCCAGGCAGGCCTGGATGGG - Intronic
1026929531 7:74216129-74216151 CAGCCACGTCTGGGCCTGAGAGG - Intronic
1027499582 7:78932058-78932080 CAGCCAAAGGAGGCCAGGAGGGG - Intronic
1029180092 7:98694238-98694260 CAGACAGGTCAGGCCAGGCGAGG + Intergenic
1029705333 7:102272998-102273020 AAGCAAAGTGAGGCCCAGAGAGG + Intronic
1033519888 7:142149829-142149851 CATCCAAGTAAGGCCGGGCGCGG - Intronic
1033602089 7:142895811-142895833 CAGGCAACTAAGGCCCAGAGAGG - Intergenic
1034264115 7:149773092-149773114 CAGCCAGGTAAGGGCCGGGGAGG - Exonic
1035251643 7:157601544-157601566 CTGCCCAGTAAGGCCTGGAGAGG + Intronic
1037814664 8:22105634-22105656 CAGCCAAGAGAGGCAGGGAGGGG + Intergenic
1038333985 8:26631749-26631771 CAGCCCAGTGAGGCGAGGAGGGG + Intronic
1039789081 8:40859768-40859790 CAGCCAAGTTAGGTCATGAGGGG + Intronic
1045323607 8:101100616-101100638 AAGACAAGTCAGGCCGGGTGAGG - Intergenic
1048001814 8:130385173-130385195 GAGCCAAGGCAGGCCGGGTGTGG + Intronic
1048252106 8:132875228-132875250 CAGGCAGGCCAGGCCTGGAGGGG - Intronic
1048522371 8:135168788-135168810 CAGCAAAGTCAGGAGCAGAGTGG + Intergenic
1049180857 8:141221449-141221471 CAGCCCAGCCAGGCCCACAGAGG + Intronic
1051072312 9:13186272-13186294 GAGCCAAGTCAGCCCTGAAGAGG + Exonic
1052494863 9:29213159-29213181 CAGCCAAGTTGGCCCAGGAGGGG - Intergenic
1054997426 9:71407949-71407971 CAGGCAAATAGGGCCCGGAGTGG + Intronic
1056588359 9:87944180-87944202 CAGCCAGGTCAGGCCCGGTGAGG - Intergenic
1056870688 9:90274920-90274942 CACTCAAGTCAGGCCAGCAGGGG + Intergenic
1056936730 9:90920197-90920219 CAGCCAAGGCTGTCCAGGAGGGG - Intergenic
1057103742 9:92390972-92390994 CAGCAAAATCAGGCCAGGTGTGG + Intronic
1057199479 9:93132629-93132651 CAGCCCAGACAGGGCAGGAGAGG - Intronic
1059324168 9:113493539-113493561 CAGCCAAGTCAAGCGAGGGGTGG - Intronic
1059391040 9:113999626-113999648 CAGCCAAGTCAAGGCCTGATTGG - Intronic
1061922333 9:133788956-133788978 AACCCAAGACAGGCCCAGAGTGG - Intronic
1062024111 9:134332555-134332577 CAGCAAGGTCTGGCCTGGAGGGG + Intronic
1062205283 9:135333118-135333140 CAGCCACGACAGGGCCAGAGAGG - Intergenic
1062253151 9:135608375-135608397 CAGCTGAGTCAGGCCCGTCGTGG + Intergenic
1189235423 X:39483456-39483478 CAGCCAAGTCTAACCCAGAGAGG + Intergenic
1190596754 X:52059630-52059652 CAGCCAACTGAGGCTCCGAGAGG - Intergenic
1190612070 X:52194443-52194465 CAGCCAACTGAGGCTCCGAGAGG + Intergenic
1190929524 X:54935639-54935661 CAGCCAACTGAGGCCTTGAGAGG + Intronic
1192177351 X:68894389-68894411 CAGCCAGGCCTGACCCGGAGAGG + Intergenic
1193954249 X:87838995-87839017 CAGACAACTCAAGCCAGGAGAGG + Intergenic
1196965110 X:121047422-121047444 CAGGCCAGCCAGGCCCGGCGAGG + Intergenic
1197606329 X:128589911-128589933 CAGACAAGGCAGGCCGGGTGCGG + Intergenic
1199359893 X:146906298-146906320 AGGGCAAGTCAGGCCTGGAGTGG + Intergenic