ID: 1016965801

View in Genome Browser
Species Human (GRCh38)
Location 6:149717881-149717903
Sequence AGCGTCCGCCCTCAGGCCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016965801_1016965812 24 Left 1016965801 6:149717881-149717903 CCACGGGCCTGAGGGCGGACGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1016965812 6:149717928-149717950 AACCCCAAGTATCCCTGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 111
1016965801_1016965809 19 Left 1016965801 6:149717881-149717903 CCACGGGCCTGAGGGCGGACGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1016965809 6:149717923-149717945 CCAGCAACCCCAAGTATCCCTGG 0: 1
1: 0
2: 1
3: 19
4: 275
1016965801_1016965811 23 Left 1016965801 6:149717881-149717903 CCACGGGCCTGAGGGCGGACGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1016965811 6:149717927-149717949 CAACCCCAAGTATCCCTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 97
1016965801_1016965810 22 Left 1016965801 6:149717881-149717903 CCACGGGCCTGAGGGCGGACGCT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1016965810 6:149717926-149717948 GCAACCCCAAGTATCCCTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016965801 Original CRISPR AGCGTCCGCCCTCAGGCCCG TGG (reversed) Exonic
902920660 1:19664751-19664773 ATCTTCGGCCCACAGGCCCGGGG + Intergenic
903623462 1:24714831-24714853 AGCCTCCTCCCTCAGACCTGAGG + Intergenic
904690800 1:32292115-32292137 TCCGTCCGCCCTCCCGCCCGCGG - Exonic
915310272 1:155002864-155002886 CGCGTCCCCCACCAGGCCCGGGG - Exonic
920675337 1:208034304-208034326 AGCCTGCGCCCTCAGAGCCGTGG - Intronic
921190040 1:212700315-212700337 TGCGTCCGCCCCCCGGCGCGGGG + Intergenic
922758462 1:228109555-228109577 TCCGTCCTCCCTCAGACCCGCGG - Intergenic
1069602695 10:69718100-69718122 GGCGCCCACCCTCAGGCCCCAGG - Intergenic
1070570816 10:77638273-77638295 CGCGTCCGGCCGCCGGCCCGTGG + Intronic
1071464208 10:85924874-85924896 AGCGCCCGCTCACAGCCCCGGGG + Intronic
1077497233 11:2892205-2892227 AGCTTCAGCCCTCAGGCTCCAGG - Intronic
1083596293 11:63919534-63919556 ATCGTCCTCCCCCAGGCCTGGGG + Intergenic
1084359359 11:68659688-68659710 TGCGTCGGCCCTCAGGCCCCAGG + Intergenic
1089374662 11:117986064-117986086 ACCTTCCGCACTCAGGGCCGAGG + Intergenic
1092409374 12:8242479-8242501 AGTCAGCGCCCTCAGGCCCGCGG - Intergenic
1099952969 12:89324529-89324551 AGCGACTTCCCTCAGGCCCCAGG + Intergenic
1102997381 12:117360965-117360987 AGCGGGCGGCCTCAGGCCGGGGG - Intronic
1103336643 12:120194809-120194831 AGCGGCCGCCGTCCTGCCCGGGG - Intergenic
1107559748 13:41548226-41548248 AGCCTCGGCCCTGAGGCCCATGG + Intergenic
1111986503 13:95071454-95071476 AGCTCCAGCCCTGAGGCCCGGGG + Intronic
1113579847 13:111421127-111421149 AGCTTCAGCCCCCAGGCCAGGGG - Intergenic
1122549761 14:102543603-102543625 AGCCTCTGCCCTCAGCCCCTGGG + Intergenic
1126348277 15:47718475-47718497 AGCGGCCGCCCTCCGGGCCTGGG - Exonic
1128506748 15:68278097-68278119 GGGGTCCGGCCTGAGGCCCGGGG + Exonic
1128594367 15:68930537-68930559 ACCGTCCTGCCTCAGGCCCTGGG - Exonic
1132544540 16:527335-527357 AGCGGCCGCCCAGAGCCCCGCGG + Intergenic
1133020181 16:2963706-2963728 AGCTTCCTCCGTCAGGCCAGCGG + Intergenic
1133078051 16:3295206-3295228 AGCGGCAGCCCCGAGGCCCGGGG - Intronic
1136585359 16:31180791-31180813 AGCCTCCGCCCCCAGCCGCGTGG - Intronic
1142104691 16:88296012-88296034 AGCGTCCCCCCTCGGGCTCTCGG + Intergenic
1142158765 16:88546530-88546552 AGCCACCGCACCCAGGCCCGAGG + Intergenic
1142237542 16:88929343-88929365 CGGGTCCTCCCGCAGGCCCGTGG - Intronic
1142338758 16:89507612-89507634 AGGGTCCGCCCTCCGGGCCCGGG - Intronic
1142812337 17:2401161-2401183 AGCCCCCGCCCGCAGGGCCGCGG + Intergenic
1144732623 17:17537342-17537364 AGCATCTGCCCTCTGGCCGGTGG - Intronic
1145248917 17:21286843-21286865 AGGGACCTCCCTCAGGCCCAGGG + Intronic
1147571198 17:41572137-41572159 AGCCTCCCCCCACAGACCCGAGG + Intergenic
1147915597 17:43883418-43883440 AGGGTCCTCCCTCAGCCCCCAGG + Intronic
1148694458 17:49550536-49550558 AGCCTCCGTCCTCAGTCCTGTGG + Intergenic
1156464571 18:37340591-37340613 GGGGTCCACCCTCAGGCCTGTGG - Intronic
1160857477 19:1224018-1224040 AGGGTCCACCCCCGGGCCCGAGG + Intronic
1163173919 19:15551460-15551482 CGCGCCCACGCTCAGGCCCGCGG - Exonic
1163731572 19:18952655-18952677 AGTTTCCTCCCTCAGGCCCTGGG - Intergenic
1164356681 19:27442270-27442292 TGTGACCGCCCTCAGGCCTGTGG + Intergenic
1164937372 19:32224768-32224790 AGTGTCCGCTCGCAGACCCGTGG - Intergenic
1167314984 19:48757723-48757745 CGCCTCCTCCCTCAGACCCGGGG - Intronic
1168571880 19:57477298-57477320 AGCCGCCGCCATCAGGCCTGTGG + Exonic
1168694178 19:58395672-58395694 AGCCTCCTCCCTCTGGCCAGTGG - Intergenic
925607333 2:5672914-5672936 AGCGCCCGCCGGCAGGCTCGGGG + Intergenic
925925226 2:8665302-8665324 AGCGGCCACCCTCGGGCCCCGGG + Intergenic
926246391 2:11124619-11124641 CGCATCCTCCTTCAGGCCCGCGG - Intergenic
926313307 2:11691170-11691192 AGGGTCCACCCTCAGTCCTGTGG + Intronic
938104178 2:128519202-128519224 GGCGGCCGACCTCCGGCCCGAGG - Intergenic
938499490 2:131823016-131823038 AGAGACCTCCCTCAGGCCCTAGG + Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
1168973562 20:1947470-1947492 AGGGTCCTCCCTCAGGGCCTCGG - Intergenic
1170832958 20:19859257-19859279 GGCGTCCACCCTCAGGCACAGGG + Intergenic
1173548525 20:43916355-43916377 TGAGTGCGCCCTCAGGCCCCAGG + Intronic
1173749995 20:45469477-45469499 AGCCTTGGCCCTCAGGCCCCAGG + Intergenic
1175515115 20:59564463-59564485 AGCGTCCGCCCCCAGGCCAAGGG + Intergenic
1175891386 20:62317549-62317571 AGAGCCCGCCCTCAGGGTCGTGG - Intronic
1175920923 20:62450352-62450374 AGCGTCCTCCCTATGGCCTGAGG - Intergenic
1176194382 20:63830788-63830810 CGCCTCCGCGCTCAGCCCCGCGG + Intronic
1180199484 21:46215872-46215894 ACCATCCGCCCTCAGGGCCCTGG + Intronic
1181478232 22:23181344-23181366 CGGGACCGCCCGCAGGCCCGGGG + Exonic
1183665473 22:39243774-39243796 AGCGCCCGGCGTCAGGCTCGCGG + Intronic
957054637 3:75434651-75434673 AGTCAGCGCCCTCAGGCCCGCGG - Intergenic
967477825 3:189941447-189941469 AGCTTCCCCACTAAGGCCCGGGG - Intergenic
968086004 3:195874140-195874162 AGAGTCCGGCGTCTGGCCCGCGG - Intronic
969405242 4:6987242-6987264 CGCGTCCGCCCGCCCGCCCGCGG + Intronic
969756567 4:9153733-9153755 AGTCAGCGCCCTCAGGCCCGCGG + Intergenic
984702473 4:182827114-182827136 AGCCTCCTCACTCAGGCCCGAGG - Intergenic
985884867 5:2670046-2670068 AGCGTGGTCCCGCAGGCCCGGGG - Intergenic
989379417 5:40798414-40798436 AGCGCCCGCCCACCGGCACGCGG + Intergenic
990043470 5:51399511-51399533 TCCGTGCGCCCTCAGGCCCCTGG + Intergenic
997449198 5:133968290-133968312 ACCCTCCGTCCTCAGGCCCGCGG + Intronic
1002184233 5:177446869-177446891 CGCCTCCCCCCGCAGGCCCGGGG + Exonic
1002925712 6:1604807-1604829 GGCGTCGGCCCTCAGGTCCTCGG + Intergenic
1012475803 6:99613829-99613851 GGCGTCCGCCTTCAAGCACGTGG + Exonic
1013273080 6:108560485-108560507 CCCGTTCGCCCTCTGGCCCGCGG + Intronic
1016965801 6:149717881-149717903 AGCGTCCGCCCTCAGGCCCGTGG - Exonic
1019367884 7:644642-644664 AGCGTCCACCCCCAGGCCTCCGG + Intronic
1019645461 7:2126476-2126498 ATCTTCCCCCCTCAGGCCTGGGG + Intronic
1034342813 7:150368970-150368992 AGCGGCCCCCCGCGGGCCCGCGG - Intronic
1036379801 8:8229041-8229063 AGTCAGCGCCCTCAGGCCCGCGG + Intergenic
1036849762 8:12193611-12193633 AGTCAGCGCCCTCAGGCCCGCGG - Intronic
1036871126 8:12435884-12435906 AGTCAGCGCCCTCAGGCCCGCGG - Intronic
1037336852 8:17800925-17800947 AGCTTCGGCCCCCAGGCCCCTGG + Intergenic
1049145908 8:141001025-141001047 CCCCTCCGCCCTCAGGGCCGCGG + Intronic
1049694362 8:143976347-143976369 TGCCTCCGCCCTCAGGCCAAGGG + Intronic
1051418740 9:16870533-16870555 CGTGTCCGCCCTCCGGCCCGCGG - Intronic
1061991905 9:134163708-134163730 AGCCTCCGCCCCGAGCCCCGTGG - Intergenic
1062702913 9:137917448-137917470 AGGGCCTGCCCTCAGGCCCAGGG - Intronic
1189591561 X:42517872-42517894 AGCTGCCACCCTCAGGCCCTGGG + Intergenic
1198268527 X:135032736-135032758 AGCACCCGCCCCCAGGCCCGAGG - Exonic
1198270440 X:135051734-135051756 AGCACCCGCCCCCAGGCCCAAGG + Exonic