ID: 1016968676

View in Genome Browser
Species Human (GRCh38)
Location 6:149742440-149742462
Sequence ATCGTTACAGTTGGAGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968676_1016968681 10 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG 0: 2
1: 0
2: 2
3: 8
4: 126
1016968676_1016968683 24 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1016968676_1016968684 28 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968676 Original CRISPR ATCGTTACAGTTGGAGAGGA TGG (reversed) Exonic
903665514 1:25005029-25005051 GAGGCTACAGTTGGAGAGGAGGG - Intergenic
908389875 1:63674798-63674820 ATCATTCGAGTTGGGGAGGAGGG - Intergenic
912730759 1:112101020-112101042 ATCTTTCCAGGTGGAGATGATGG - Intergenic
913243296 1:116849424-116849446 ATCCTTACAGCTTGAGAGGTTGG - Intergenic
913532911 1:119745497-119745519 ATATTTCCAGTTGGAGAGAATGG - Intergenic
915589069 1:156860554-156860576 ATTTTTACATTTGGGGAGGAGGG - Intronic
917148196 1:171915321-171915343 ACTGTTAAAGTTGGATAGGAGGG + Intronic
921556957 1:216610492-216610514 ATCGTTAGTGTTTGAGGGGAAGG + Intronic
922539216 1:226406581-226406603 AACGTTACCGTAAGAGAGGATGG - Intronic
924619452 1:245648028-245648050 ACCGTTGGAGTTGGAGATGAAGG + Intronic
1073214804 10:101830318-101830340 ATGGTGACAGGTGTAGAGGATGG - Intronic
1074060558 10:109961769-109961791 ATAGTTACATTTGGGGAGGGTGG + Intergenic
1075846647 10:125550444-125550466 ATTTTTCAAGTTGGAGAGGATGG + Intergenic
1079147347 11:17865463-17865485 ATTGTTACCATTGGAGATGATGG + Intronic
1079689205 11:23400988-23401010 ATCATGACAGTTGGAGAAAAGGG - Intergenic
1079968413 11:27006615-27006637 ATCTTTGCAGATGGACAGGAGGG + Intergenic
1087225341 11:95592557-95592579 AGGGTTACAGTGGGAGATGAGGG + Intergenic
1090304778 11:125681956-125681978 ATTGTTACATTTTGAAAGGAAGG + Intergenic
1090768857 11:129901284-129901306 TTCTTTAAAGTTGGACAGGAAGG - Exonic
1093130541 12:15386852-15386874 AACTTGACTGTTGGAGAGGAAGG - Intronic
1095907767 12:47395258-47395280 AAAGTTACAATTAGAGAGGAGGG - Intergenic
1095987849 12:48011424-48011446 ACAGTTACAATTGCAGAGGAAGG - Intergenic
1101872326 12:108576245-108576267 ATCATTACACTTGGTGAAGAAGG - Intergenic
1102374236 12:112408785-112408807 ATGGGTAGAGTTTGAGAGGAAGG - Intronic
1107378069 13:39826052-39826074 ATTGTTTCAGTTGGATAGAAAGG - Intergenic
1111243531 13:85507051-85507073 CTAGTTACACTTGCAGAGGATGG + Intergenic
1111486079 13:88901764-88901786 ATACTTACAGTTAGAGGGGAGGG - Intergenic
1114214326 14:20644538-20644560 ATCCTTGGAGTTGGGGAGGATGG + Intergenic
1115148888 14:30260317-30260339 AGCGTTATAGTTGGAGAAAATGG - Intergenic
1120258570 14:82153089-82153111 ATAGTTACAGTTTGGAAGGATGG - Intergenic
1202902909 14_GL000194v1_random:53471-53493 ATCCCAACAGTTGGAGATGAGGG - Intergenic
1123884655 15:24713813-24713835 AATGTTACAGATGGAGAGGAAGG - Intergenic
1125437680 15:39664870-39664892 ATTTTTACAGTTAGAGAGGAGGG - Intronic
1127027405 15:54822095-54822117 ATAGTTTGAGGTGGAGAGGAGGG + Intergenic
1137781806 16:51103703-51103725 TTTGTCACAGTTGGAGAGGGAGG + Intergenic
1138268804 16:55680011-55680033 GTTGTTACATCTGGAGAGGAGGG - Intronic
1139194456 16:64902853-64902875 ACTGTTAGAGTTGGAGAGAAAGG + Intergenic
1140290404 16:73648985-73649007 ATCTTTACATTTGGAGATTACGG + Intergenic
1146265486 17:31450094-31450116 AGAGTTACAGTTCTAGAGGAGGG - Intronic
1151885188 17:76919330-76919352 AACGTGACAGCTGGAGAAGATGG + Intronic
1156141485 18:34116880-34116902 ATTGTTGCAATTAGAGAGGAAGG - Intronic
1160395952 18:78572402-78572424 ATGGTTACAGGTGAGGAGGACGG + Intergenic
1164244169 19:23416089-23416111 AGTGGCACAGTTGGAGAGGAGGG - Intergenic
1166217486 19:41345025-41345047 ATGGGTACTGTTGGGGAGGATGG - Intronic
926035999 2:9636329-9636351 ATGGTGGCAGTGGGAGAGGAGGG - Intergenic
928888258 2:36174918-36174940 ATTGTTACAACTGGTGAGGAAGG + Intergenic
929311265 2:40428689-40428711 ATAGTTACAGTGGCAGTGGAGGG + Exonic
929762731 2:44819484-44819506 CTGGTTACCTTTGGAGAGGAAGG + Intergenic
929931049 2:46255800-46255822 ATAGTGAAAATTGGAGAGGAGGG - Intergenic
930630837 2:53753370-53753392 TTTCTTACTGTTGGAGAGGAAGG + Intronic
934503751 2:94876923-94876945 ATCCTAACAGTTGGAGATGAGGG + Intergenic
934768341 2:96893147-96893169 ATCGTTATAATTGGGGAAGATGG - Intronic
936678859 2:114747696-114747718 ATCATTCCAGTTGGAGATCATGG + Intronic
943538914 2:189187046-189187068 ATCGTTACATTTAGAGATTATGG + Intergenic
944004708 2:194890595-194890617 GTAGTTTCAGTGGGAGAGGAGGG - Intergenic
944161441 2:196664674-196664696 CTCGTTAGAGGTTGAGAGGAGGG + Intronic
944219387 2:197287153-197287175 ATGGTGACAGTGGGAGAGGCTGG + Intronic
1169497233 20:6127035-6127057 ATCCATCCAGTTGGGGAGGAGGG - Intergenic
1171516248 20:25740014-25740036 ATAGTTACAGGTGGATAAGATGG - Intergenic
1172984491 20:38972945-38972967 ATAGTTACAGTTGAAGGGGTGGG + Intronic
1173910739 20:46668195-46668217 ATGGTTACACTTAGTGAGGAAGG + Intronic
1175077524 20:56388871-56388893 AGCTTTGCTGTTGGAGAGGAGGG - Intronic
1175297319 20:57917850-57917872 ATCCTGACAGATGGGGAGGAAGG + Intergenic
1175614711 20:60387468-60387490 AAAGTTACAGCTAGAGAGGAAGG + Intergenic
1176622273 21:9068238-9068260 ATCCCAACAGTTGGAGATGAGGG - Intergenic
1178225275 21:30709961-30709983 TTCATTAAAGTTGGAGAGAAAGG - Intergenic
1182159121 22:28104187-28104209 AACTTTACAGTTGCAGAGTAGGG - Intronic
1182656698 22:31896062-31896084 ATAGTTATAGTTGGGCAGGAAGG + Intronic
1184365446 22:44048058-44048080 AGCTTTGCAGTTGGAGAGGATGG + Intronic
952904865 3:38133062-38133084 ATGGCTACTGCTGGAGAGGAAGG + Intronic
963291590 3:143495648-143495670 AGCCTTACAGTTGGAAAGAATGG - Intronic
971960235 4:33477140-33477162 AGAATTACAGTCGGAGAGGAAGG - Intergenic
978122961 4:105103565-105103587 ATCATTAATGTTGGAGATGATGG - Intergenic
979391405 4:120132241-120132263 ATCGTTCCAGTTGGACAAAATGG + Intergenic
981493136 4:145362764-145362786 AGCGTCAAAGTTTGAGAGGATGG + Intergenic
983832689 4:172348510-172348532 ATGCTTACAGCTGGAGATGAGGG - Exonic
985233933 4:187852195-187852217 ACCATTCCAGTTGGTGAGGAAGG - Intergenic
988308003 5:29518727-29518749 ATCTTTGCATTTGAAGAGGAAGG - Intergenic
989812743 5:45696680-45696702 AACGTTACAGATGGAGAAAAGGG + Intergenic
989950232 5:50288673-50288695 ATGTTTACAGTTGGATAGGAAGG - Intergenic
990608943 5:57438395-57438417 ATCCTGACTGTTGGAGAGGAAGG + Intergenic
991609277 5:68434224-68434246 ATAGTTTCAGATGCAGAGGACGG + Intergenic
991661802 5:68958280-68958302 ATCATTAGAGGTGGAGAAGAGGG + Intergenic
991977052 5:72193785-72193807 ATAGTTATAGCTGGAGATGATGG + Intronic
997303408 5:132822777-132822799 ATAGTTATAGGTGGAGAGGGTGG - Exonic
998813088 5:145986054-145986076 ATCGTTAGAGTTGGGAAGAATGG + Intronic
1000075848 5:157785108-157785130 ATAGTTACATTTGGAGGGAAGGG - Intergenic
1001687625 5:173606223-173606245 ATCGTTACTGTTGGGATGGACGG - Intergenic
1002044971 5:176536711-176536733 AGCGCTGCGGTTGGAGAGGAAGG - Intronic
1004110302 6:12711422-12711444 ATGGATACAGTTGGAGTGGATGG + Intergenic
1005133817 6:22543376-22543398 CTAGTCATAGTTGGAGAGGAAGG - Intergenic
1011719283 6:90138732-90138754 ATCGGTAGAGCTGGAGAGGTGGG - Intronic
1016960082 6:149665039-149665061 TTATTTACAATTGGAGAGGAAGG - Intronic
1016968676 6:149742440-149742462 ATCGTTACAGTTGGAGAGGATGG - Exonic
1017132439 6:151119225-151119247 AGAGTTTCAGTTGGAAAGGATGG + Intergenic
1021793437 7:24228875-24228897 ATTGTCACAGTTGGAAAGGAGGG - Intergenic
1022043055 7:26598739-26598761 GCGGTTGCAGTTGGAGAGGATGG + Intergenic
1023341752 7:39228663-39228685 ATTGTTTCAGATGGACAGGATGG - Intronic
1023785929 7:43707531-43707553 ATAGTTACCTTTGGAGAGGAGGG - Intronic
1024027698 7:45427042-45427064 ATCATTATATTTGGGGAGGAAGG + Intergenic
1024672377 7:51607913-51607935 ATCCTTACAGTGGAGGAGGAGGG - Intergenic
1028789749 7:94840567-94840589 GTCACTTCAGTTGGAGAGGAAGG + Intergenic
1028807847 7:95049461-95049483 ATCTTAACAGTAGGAGAGGCTGG - Intronic
1033459031 7:141528741-141528763 AAAGATACTGTTGGAGAGGAGGG - Intergenic
1035012096 7:155728277-155728299 ACCTTTACAGGTGGAGAGGCTGG - Intronic
1035653440 8:1286594-1286616 ATCATTACAGCAGCAGAGGAGGG - Intergenic
1041443872 8:57929132-57929154 ATCTTTACAGTGGAAAAGGAAGG + Intergenic
1042963203 8:74324041-74324063 ATGGTAACGGTTGGAGAAGACGG + Intronic
1044631824 8:94287665-94287687 ATAGATATAGATGGAGAGGAAGG + Intergenic
1044704870 8:94998908-94998930 TTTGTTACGGTTGGAGAGCAGGG + Intronic
1047556411 8:125936265-125936287 ATCCTTGCATTTGGAGGGGAGGG + Intergenic
1052780557 9:32778483-32778505 ATCGTAACAATAGGATAGGAAGG - Intergenic
1056832282 9:89926976-89926998 ATGCTGACAGTTGGAGAGGTAGG - Intergenic
1059759642 9:117325744-117325766 ATTGTTAGAGATGGAGAGGCTGG + Intronic
1060482459 9:124024944-124024966 AGCAGTACAGTGGGAGAGGAGGG + Intronic
1061145901 9:128798273-128798295 AACATTCCAGGTGGAGAGGAGGG + Intronic
1061176298 9:128999485-128999507 ATCTGTCCAGTGGGAGAGGAGGG - Intronic
1061315878 9:129795519-129795541 CTCGTGGCAGTGGGAGAGGAGGG + Intergenic
1203745469 Un_GL000218v1:38668-38690 ATCCCAACAGTTGGAGAAGAGGG - Intergenic
1203564640 Un_KI270744v1:80816-80838 ATCCCAACAGTTGGAGATGAGGG + Intergenic
1185761680 X:2693395-2693417 ATCCTTCCAATTGCAGAGGAGGG + Intronic
1187223808 X:17356260-17356282 AACGGTCCAGCTGGAGAGGAAGG + Intergenic
1188514094 X:30966545-30966567 ACTGTTACTGTTGGAGGGGAAGG + Intronic
1188566023 X:31527311-31527333 ATCCTTCCAGTTGGACAGGTTGG + Intronic
1189023084 X:37362755-37362777 ATCCTTACCGTTGGAGTGGGTGG + Intronic
1189575760 X:42351382-42351404 AACTTTAAAGTTTGAGAGGAAGG + Intergenic
1197129742 X:122991451-122991473 ATAGAGACAGTTGGAGAGGTTGG - Intergenic
1197701247 X:129601721-129601743 ATCGAGGCAGTTGGAGAGGCGGG + Intergenic
1198677424 X:139145695-139145717 ATTTATCCAGTTGGAGAGGAGGG - Intronic
1201590523 Y:15610296-15610318 ATCGTCAAAGTTGGAGATGTAGG - Intergenic