ID: 1016968677

View in Genome Browser
Species Human (GRCh38)
Location 6:149742444-149742466
Sequence AGAAATCGTTACAGTTGGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968677_1016968684 24 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1016968677_1016968683 20 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1016968677_1016968681 6 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG 0: 2
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968677 Original CRISPR AGAAATCGTTACAGTTGGAG AGG (reversed) Exonic
903067507 1:20708898-20708920 AGAGAACGTTACAGAGGGAGAGG + Intronic
908112212 1:60908893-60908915 AGGACTGGTTACAGGTGGAGTGG + Intronic
908813864 1:68011673-68011695 AGATTTAGTTACAGTTAGAGAGG - Intergenic
919026707 1:192180926-192180948 AGAAGCCATTACAGTTGGAACGG - Intronic
921025416 1:211275736-211275758 AAAAATTGTTAAAGTTGCAGTGG + Intronic
922070184 1:222184460-222184482 TGAAATTCTTACAATTGGAGTGG - Intergenic
923550336 1:234958498-234958520 AGAAATGGTTACAGCTGCTGGGG + Intergenic
1065675758 10:28172293-28172315 AGAAATAGGTACTGTTGGAATGG + Intronic
1068397110 10:56477131-56477153 AGAAACCTTCACATTTGGAGAGG - Intergenic
1068847987 10:61702442-61702464 AGGATTGCTTACAGTTGGAGTGG + Intronic
1069773416 10:70913415-70913437 AGAAATCCAGACAGTTAGAGAGG + Intergenic
1074053384 10:109900064-109900086 AGAAACCCTTAGAGTTGCAGAGG + Intronic
1080231356 11:30020121-30020143 AAAAATCATAAGAGTTGGAGTGG + Intergenic
1086379955 11:86242293-86242315 AGGAACCATCACAGTTGGAGAGG - Intergenic
1086972297 11:93096165-93096187 AGACAAGGTTAGAGTTGGAGTGG + Intergenic
1089356258 11:117855823-117855845 AGAAATCATCACTGCTGGAGTGG + Intronic
1090458193 11:126867463-126867485 AGAAAGAGTAACAGATGGAGTGG - Intronic
1090472458 11:126992238-126992260 AGAGAATCTTACAGTTGGAGAGG + Intronic
1095090582 12:38100180-38100202 AGAAATGGTTAGAGTTGGCAGGG + Intergenic
1095924971 12:47569425-47569447 ATAAATATTTACAGTTGGGGTGG + Intergenic
1095975582 12:47938903-47938925 AGAACTCATCCCAGTTGGAGGGG - Intronic
1096682986 12:53269222-53269244 AGAATTCGTTCCAGGTAGAGGGG - Exonic
1097007946 12:55932233-55932255 AGGAAGCGTGACAGCTGGAGCGG + Intronic
1100596963 12:96080028-96080050 AGAAATCGTAACAGGTGGACTGG - Intergenic
1106307784 13:28528731-28528753 AGAAATGCTCAGAGTTGGAGGGG - Intergenic
1109691734 13:65902167-65902189 AGCAATTGTTAGAGTTGTAGAGG - Intergenic
1109893584 13:68652700-68652722 AGAAAGTATTAAAGTTGGAGTGG + Intergenic
1112339262 13:98538921-98538943 AGAAATTGTGACAGGTGGCGAGG - Intronic
1112543979 13:100346362-100346384 GGAAATAGCTACAGTTGGGGTGG + Intronic
1118899606 14:69975359-69975381 AGAATTTTTTACAGTTGGATGGG + Intronic
1118923387 14:70170040-70170062 AGAACTAGTGAGAGTTGGAGTGG - Intronic
1127027403 15:54822091-54822113 AGAAATAGTTTGAGGTGGAGAGG + Intergenic
1128578349 15:68791421-68791443 AGAAACAGTTACAGCTGTAGGGG - Intronic
1129593509 15:76939319-76939341 ATAAATGGTAGCAGTTGGAGGGG + Intronic
1130381871 15:83378818-83378840 AGAGAGCGCTACAGTTGGTGTGG - Intergenic
1131646289 15:94348636-94348658 AGAAAGCGGTACAGTGAGAGAGG - Intronic
1136079842 16:27844823-27844845 AGAAATGGGGAGAGTTGGAGGGG - Intronic
1137775513 16:51050942-51050964 CCAGATCGTTACAGTTGGAGGGG - Intergenic
1144156940 17:12513675-12513697 AGAAACCTTTACAGTGTGAGGGG - Intergenic
1145232557 17:21184793-21184815 AAAAATCTTAACAGTAGGAGTGG - Intronic
1146598655 17:34192279-34192301 AGACATCGTCACCCTTGGAGTGG + Intergenic
1153424719 18:4949628-4949650 TGAAATAGTTTCAGTAGGAGTGG - Intergenic
1157302456 18:46488892-46488914 AGACACCGTTCCAGCTGGAGGGG - Intronic
1157664298 18:49472880-49472902 AGAAATCATTTCAGATGGAGGGG - Intergenic
1158485296 18:57860837-57860859 AGAGCTCAGTACAGTTGGAGTGG - Intergenic
1158859829 18:61581534-61581556 GGAAGTCGTCACAGTGGGAGGGG + Intergenic
1160177292 18:76605894-76605916 AGAAATGGTTACAGTAGGAATGG - Intergenic
1164929733 19:32166237-32166259 ACAAATCGATACATTTGCAGTGG + Intergenic
1166691374 19:44823092-44823114 AGAGATCATTGCAGTTGGAAAGG + Intergenic
1167044490 19:47041633-47041655 AGAAAGCTTTAGAGCTGGAGAGG + Intronic
927426925 2:22991278-22991300 AGAAAAGGTTAGACTTGGAGAGG - Intergenic
928402023 2:30985916-30985938 AAAAATCTTTACAGCTGGAATGG - Intronic
929311263 2:40428685-40428707 AAAAATAGTTACAGTGGCAGTGG + Exonic
931711395 2:64991207-64991229 AGAAATGGAAACAGTTGGAAAGG - Intronic
941909235 2:170746983-170747005 AGAAATCATTCCAGTTACAGTGG + Intergenic
942210075 2:173661164-173661186 GGAAATCGCCAAAGTTGGAGTGG + Intergenic
947273742 2:228368425-228368447 AGAAATCGTTAGAGCAGGAAAGG + Intergenic
948414388 2:237791687-237791709 AAAAATGATTATAGTTGGAGAGG - Intronic
948678590 2:239614452-239614474 AGAAATCATAACTGTTTGAGGGG - Intergenic
1170548109 20:17452240-17452262 AGATATCCCTACAGTTGGTGTGG - Intronic
1171348826 20:24487123-24487145 AGAAATGGCTTCAGCTGGAGAGG + Intronic
1172984489 20:38972941-38972963 TTAAATAGTTACAGTTGAAGGGG + Intronic
1173910738 20:46668191-46668213 AGAAATGGTTACACTTAGTGAGG + Intronic
1177078591 21:16609932-16609954 AGAAAGCGTTATAGATGGAGGGG - Intergenic
1181100831 22:20537654-20537676 AGAACTCGCCACAGGTGGAGTGG + Intronic
1182710361 22:32318857-32318879 ACAAACCATTACCGTTGGAGTGG - Intergenic
949665663 3:6336346-6336368 AGAAATTGGTACAGCTGCAGAGG - Intergenic
949814948 3:8048576-8048598 AAAAATAGTTAAAATTGGAGGGG - Intergenic
953746040 3:45574786-45574808 TGAAATCTATACATTTGGAGAGG - Intronic
957277864 3:78112286-78112308 AGAAAATGCTCCAGTTGGAGTGG - Intergenic
957525056 3:81369804-81369826 AGAAATAGTTACAGTTAATGTGG - Intergenic
957587346 3:82149120-82149142 AGAAAACGTTACAGATAGAAAGG - Intergenic
959993505 3:112655028-112655050 AGAGATTGGTCCAGTTGGAGAGG - Intergenic
969203762 4:5626421-5626443 AGAATTGCTTAAAGTTGGAGGGG - Intronic
969491782 4:7503588-7503610 AGAAACAGTAACAGCTGGAGAGG + Intronic
969674002 4:8604985-8605007 AGAGCATGTTACAGTTGGAGAGG - Intronic
972487190 4:39553356-39553378 AGAAATCATTACAGTGGGCTGGG - Intronic
972560230 4:40220539-40220561 AGAAATGATTTCATTTGGAGAGG - Intronic
973830297 4:54752700-54752722 AAAAATACTTACAGTTGGATTGG - Intergenic
975124152 4:70762888-70762910 ATTAAATGTTACAGTTGGAGGGG + Intronic
975400108 4:73927326-73927348 AGGAATCGTTTCAGTAGGAATGG - Intergenic
975696145 4:77015234-77015256 AGAAATCGTAACTGTTAGAGTGG - Intronic
975716362 4:77209185-77209207 AGTAATCTTGACAGTTGAAGAGG - Intronic
976459168 4:85287871-85287893 TGAAATAGTTTCAGTAGGAGTGG + Intergenic
979347190 4:119601954-119601976 AGAAACTGTTTCAGATGGAGGGG + Intronic
984112769 4:175640809-175640831 AGGAATTGTGACAATTGGAGAGG - Exonic
986631629 5:9779421-9779443 AGAAATGGTTAAACTTGGTGAGG - Intergenic
987838309 5:23189600-23189622 TGAAATAGTTTCAGATGGAGTGG - Intergenic
988020645 5:25615545-25615567 GGAAATCGCTTCAGCTGGAGAGG + Intergenic
991401389 5:66255389-66255411 AGAAATATTTCCAGTTGAAGAGG - Intergenic
992246825 5:74834350-74834372 AGATATTGATACAGTTGGAGGGG + Intronic
992403961 5:76438139-76438161 AGAAATAGTTTCAGTAGGATTGG + Intronic
993648484 5:90488828-90488850 AGGAAACATTATAGTTGGAGAGG + Intronic
997931662 5:138077718-138077740 AGGAAGAGTTAGAGTTGGAGGGG - Intergenic
1009643691 6:66370070-66370092 TGAAATAGTTTCAGTAGGAGTGG + Intergenic
1010612165 6:77966325-77966347 AGAAATTGATAAAGTTGAAGAGG - Intergenic
1011719285 6:90138736-90138758 AGAAATCGGTAGAGCTGGAGAGG - Intronic
1012934145 6:105348305-105348327 AGTAACCGTTACAGAGGGAGGGG + Intronic
1016968677 6:149742444-149742466 AGAAATCGTTACAGTTGGAGAGG - Exonic
1017725303 6:157272836-157272858 TGAAAACGAGACAGTTGGAGTGG + Intergenic
1021016272 7:15538950-15538972 AAAAAAAGTTACAGTTTGAGGGG + Intronic
1025721712 7:64021848-64021870 AGAAATCTATTCAGGTGGAGAGG + Intergenic
1028646605 7:93104655-93104677 AGAAATCGTCTCATTTGGTGTGG + Exonic
1036045865 8:5139881-5139903 AGAAAATTTTACGGTTGGAGAGG + Intergenic
1038872538 8:31510984-31511006 AGAAATAGTTTCAGTAGGATTGG + Intergenic
1040484490 8:47857144-47857166 ATCAATCCTTACTGTTGGAGTGG + Exonic
1040857692 8:51966596-51966618 AGAAATAGAGACAGATGGAGTGG + Intergenic
1044095832 8:88063139-88063161 AAAAATGTTTAGAGTTGGAGAGG + Intronic
1046813961 8:118563790-118563812 AGAAATGGTTACTGTTGAAATGG - Intronic
1047990010 8:130276245-130276267 AGAGATTGTTACAGCTGGAGCGG - Intronic
1050072014 9:1825071-1825093 AGAAATTATTACAGGTAGAGAGG - Intergenic
1050435378 9:5603781-5603803 AGGTATCGTTAGAGTTAGAGAGG + Intergenic
1061105554 9:128527626-128527648 ACAAATGTTTACAGTTGGATCGG + Intronic
1186853468 X:13603034-13603056 AGAAAGTGATACAGTTTGAGGGG + Intronic
1186915015 X:14209504-14209526 AGACATAGTTACTGTAGGAGGGG - Intergenic
1188514093 X:30966541-30966563 AGTAACTGTTACTGTTGGAGGGG + Intronic
1195548734 X:106142204-106142226 AGAAATAGTTTCAGTAGGAATGG - Intergenic
1198529739 X:137540138-137540160 AGAAATTGATACAGGTGGTGGGG - Intergenic
1201470543 Y:14329415-14329437 AGACATAGTTAAAGTTGGAAAGG - Intergenic