ID: 1016968680

View in Genome Browser
Species Human (GRCh38)
Location 6:149742449-149742471
Sequence AACCCAGAAATCGTTACAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968680_1016968686 29 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968686 6:149742501-149742523 TGCTATAGGAAGGACTGCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 138
1016968680_1016968681 1 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG 0: 2
1: 0
2: 2
3: 8
4: 126
1016968680_1016968685 28 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968685 6:149742500-149742522 CTGCTATAGGAAGGACTGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 121
1016968680_1016968684 19 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1016968680_1016968683 15 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968680 Original CRISPR AACCCAGAAATCGTTACAGT TGG (reversed) Exonic
904640258 1:31921556-31921578 AACACAGTAATCTTTACAGCTGG + Intronic
905609335 1:39336019-39336041 AACCCAGGAATCTTGATAGTTGG - Intronic
905812075 1:40920040-40920062 AACCCAGAAATAGGTCCAGAGGG + Intergenic
905926672 1:41755131-41755153 AACCCAGAAATAGTTCCACATGG + Intronic
906855139 1:49296155-49296177 AACCCAGAATGCCTAACAGTAGG - Intronic
909064515 1:70918683-70918705 AACCCAGAAAACATTAGAATAGG + Intronic
909731848 1:78901482-78901504 AACCCAGAAAATGATACATTTGG + Intronic
911070161 1:93825923-93825945 AAACCAGAAATGGTTCCACTAGG - Intronic
914960723 1:152204116-152204138 AAACCAGAAACCCTTACAGCAGG - Intergenic
919887238 1:201943661-201943683 AACCCAGAAACCGGTGAAGTGGG - Intronic
922374775 1:224951624-224951646 AATCCAGAAATCTACACAGTAGG - Intronic
1064151397 10:12868676-12868698 AATCCAGAAATCCTGACAGTGGG - Intergenic
1065465752 10:26019674-26019696 AACCCTGAAAACATTACACTAGG - Intronic
1065749948 10:28876489-28876511 AACCCAGAAAATGATACTGTCGG - Intronic
1078886012 11:15500645-15500667 ACCCCAGAACTAGTAACAGTGGG + Intergenic
1079863819 11:25709516-25709538 AATCAAAAAATGGTTACAGTGGG + Intergenic
1079969696 11:27021138-27021160 AAACCAGAAATCCTCACAGATGG + Intergenic
1079972025 11:27046965-27046987 AATCCAGAAAAAGTTAAAGTGGG + Intronic
1080168799 11:29273462-29273484 AACTCAGATATCTGTACAGTGGG - Intergenic
1088108630 11:106234999-106235021 AACCCAGAAATGGTCTCAGGAGG + Intergenic
1089815342 11:121168016-121168038 AAGTCAGAAATCGTTACATCTGG - Intronic
1101872327 12:108576254-108576276 AAGCTAGAAATCATTACACTTGG - Intergenic
1106438105 13:29741574-29741596 AAGCCAAAAATAGCTACAGTGGG + Intergenic
1107790376 13:43995922-43995944 AACACAGAAACTGTTACAGTAGG - Intergenic
1115016467 14:28621375-28621397 AACCCAGATATACTTACAGCAGG + Intergenic
1116039280 14:39666385-39666407 AAGCCAGAAATGGGCACAGTGGG - Intergenic
1117075908 14:52104052-52104074 AACCCAGAATTCCTCACATTAGG - Intergenic
1119789719 14:77339249-77339271 AACACAGAAACCCTGACAGTTGG + Exonic
1123995594 15:25715948-25715970 ACCCCAGAAAGCCCTACAGTGGG - Intronic
1127275502 15:57439774-57439796 AACCCAGAAAACTATACAATTGG - Intronic
1127563834 15:60167101-60167123 AACCCTGAAATAGGTACTGTTGG + Intergenic
1129615176 15:77093367-77093389 TACCCAGCAATCGTCTCAGTGGG - Intergenic
1129988353 15:79938727-79938749 AACCCAGAAATTGTATCTGTAGG - Intergenic
1133732395 16:8589014-8589036 AAACCACAAAACGTTACAGGTGG + Intronic
1144435426 17:15235593-15235615 ATCCTAGAAAACCTTACAGTGGG + Intronic
1146105284 17:30029933-30029955 ATCCCAGAATTCATTACATTGGG + Intronic
1149051202 17:52307457-52307479 AACCCAGAAATTGTAATAGGAGG + Intergenic
1149210964 17:54300076-54300098 AACCCAGAAATTGTAAAAGAAGG + Intergenic
1151617883 17:75226176-75226198 CACCTAAAAATGGTTACAGTGGG - Intronic
1160177293 18:76605899-76605921 ACTTCAGAAATGGTTACAGTAGG - Intergenic
929376718 2:41296265-41296287 GATCCAGCAATCGTTCCAGTGGG + Intergenic
929965012 2:46528083-46528105 AATCCAGAATTCATTACAGGTGG + Intronic
930922457 2:56773412-56773434 AACCCAGCAATCCCTACACTGGG - Intergenic
931637362 2:64352448-64352470 AACCAGGAAGTAGTTACAGTAGG + Intergenic
932017848 2:68051216-68051238 AAGACAAAAATCCTTACAGTGGG + Intronic
933899697 2:86840588-86840610 AACCCAGAAAACTTTGCAATTGG + Intronic
935780864 2:106508637-106508659 AACCCAGAAAACTTTGCAATTGG - Intergenic
938029222 2:127977928-127977950 TACCCACACATCGTTGCAGTTGG - Intronic
939329409 2:140738046-140738068 AACCCAGAGATCAGTAGAGTTGG + Intronic
941009983 2:160288452-160288474 CACCCAGAAGGAGTTACAGTTGG - Intronic
943569435 2:189555911-189555933 AGCACAGAAATCCTTCCAGTCGG - Intergenic
947260635 2:228218282-228218304 AAAGCAGAAAACGTTACAGCTGG - Intergenic
1172628495 20:36362563-36362585 AACCCAGAGCTCATGACAGTTGG + Intronic
949241186 3:1874151-1874173 AACACAGAAATTGTCACACTGGG + Intergenic
951723214 3:25724449-25724471 TACACAGAAATATTTACAGTGGG - Intronic
952155023 3:30633848-30633870 AAAGCAGAAATTGCTACAGTGGG - Intronic
955177116 3:56627581-56627603 AACCCAGAGGTTGTCACAGTTGG - Exonic
955548641 3:60059011-60059033 AACGAAGAAAATGTTACAGTAGG + Intronic
968283770 3:197496280-197496302 AAGCCAGAAATGGATACAGCAGG + Intergenic
968711091 4:2118201-2118223 CACCCCAAAATCCTTACAGTTGG - Intronic
969900316 4:10343241-10343263 AACTCAGAAATTGTTGCAGTAGG - Intergenic
972461702 4:39309983-39310005 AACCCAGCACTAGTTTCAGTGGG + Intronic
972487192 4:39553361-39553383 GACTTAGAAATCATTACAGTGGG - Intronic
972687297 4:41363176-41363198 AACCCAGAAGTTGTAACAGATGG + Intronic
974312978 4:60236493-60236515 ATCCTAGAAATTGTTACAGATGG - Intergenic
976394564 4:84542294-84542316 ATCCCTGAAATCCTTCCAGTGGG - Intergenic
977112291 4:92973366-92973388 AACAGAGAAATAGTTACAATAGG + Intronic
978122964 4:105103574-105103596 AGCCCAGAAATCATTAATGTTGG - Intergenic
978866360 4:113517128-113517150 AACCCAGAAACTGGTATAGTGGG + Intronic
983891972 4:173038798-173038820 AACCCAGAAATGTTTACAAAGGG + Intronic
989666766 5:43863548-43863570 AACCCAGAGATCATTCCATTTGG - Intergenic
992352155 5:75941125-75941147 AACCCAGAGAACCTTTCAGTTGG + Intergenic
997432993 5:133854160-133854182 AACCCAGGAATCCTTGGAGTTGG + Intergenic
1002671246 5:180869287-180869309 GACCCAGAAATGATAACAGTAGG - Intergenic
1006169890 6:32086653-32086675 AGCCCAGACATCGTTCCTGTGGG + Intronic
1006284035 6:33079560-33079582 AACCCAGAGGTCTTAACAGTAGG + Intronic
1012524134 6:100156801-100156823 ACCACAGAAATTGTTAAAGTAGG + Intergenic
1012608063 6:101182706-101182728 AGTCCAGAAATGGTTAGAGTAGG + Intergenic
1014685000 6:124486021-124486043 AACTCAGCAATCTTTAGAGTCGG - Intronic
1016968680 6:149742449-149742471 AACCCAGAAATCGTTACAGTTGG - Exonic
1018833150 6:167461462-167461484 AACCCAGCATTTGTTCCAGTCGG - Intergenic
1027446330 7:78277744-78277766 ACCCCAGGAATAGTTTCAGTAGG + Intronic
1028329378 7:89570074-89570096 AACCCAGAAATCCTGCCACTGGG + Intergenic
1028800424 7:94957907-94957929 TACCCAGAAATCATGACAGCAGG - Intronic
1029682268 7:102119659-102119681 AACCCAGAAATGGTTATAATCGG - Intronic
1042009645 8:64227876-64227898 AACCCAGAAAACCTTACAATGGG + Intergenic
1045800761 8:106097716-106097738 AACCAAGCAATGGTCACAGTGGG + Intergenic
1053566443 9:39257776-39257798 AACCCAGAAAGCTTTCTAGTAGG + Intronic
1053832221 9:42095636-42095658 AACCCAGAAAGCTTTCTAGTAGG + Intronic
1054130703 9:61361236-61361258 AACCCAGAAAGCTTTCTAGTAGG - Intergenic
1054598323 9:67091784-67091806 AACCCAGAAAGCTTTCTAGTAGG - Intergenic
1062264182 9:135679310-135679332 AGCCCAGAAGTGGTTTCAGTGGG - Intergenic
1189037643 X:37508669-37508691 AATTCAGAAGTCCTTACAGTAGG - Intronic
1191703834 X:64071510-64071532 AGCCAAGGAATGGTTACAGTAGG + Intergenic
1195549934 X:106156898-106156920 AAACCACAAATATTTACAGTAGG + Intergenic
1195747849 X:108136593-108136615 AACCCAGAGATAGAGACAGTGGG - Intronic
1196078235 X:111601309-111601331 AATCCTGAAAGCTTTACAGTAGG - Intergenic
1199082318 X:143590854-143590876 AACCCTAAGATTGTTACAGTAGG + Intergenic