ID: 1016968681

View in Genome Browser
Species Human (GRCh38)
Location 6:149742473-149742495
Sequence TTGCACACAACACCTGTACA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 2, 1: 0, 2: 2, 3: 8, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968676_1016968681 10 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG 0: 2
1: 0
2: 2
3: 8
4: 126
1016968677_1016968681 6 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG 0: 2
1: 0
2: 2
3: 8
4: 126
1016968680_1016968681 1 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG 0: 2
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968681 Original CRISPR TTGCACACAACACCTGTACA TGG Exonic
900082074 1:865991-866013 ATGCACAGAACACCTGTAAATGG - Intergenic
905314184 1:37070611-37070633 TTGCACACACCATGTATACATGG + Intergenic
909031551 1:70547199-70547221 TTTCACAGCACACCTGCACATGG - Intergenic
911242155 1:95478582-95478604 TTGCACACTTCACCTGGAAAAGG + Intergenic
912407269 1:109450917-109450939 GTCCACACAAAACCTGCACATGG + Intergenic
918670185 1:187205134-187205156 TTGCCCAGAACATTTGTACAGGG - Intergenic
923907024 1:238395949-238395971 TTGCACACACTACCTCTCCATGG + Intergenic
924137476 1:240985078-240985100 TTGAACACAACACCGGGACACGG - Intronic
1063414306 10:5861089-5861111 CTGCACACAGCTCCTGCACATGG - Intergenic
1063725377 10:8631672-8631694 TAGCTCCCAAAACCTGTACATGG - Intergenic
1067326807 10:45276382-45276404 GTGTACACAATCCCTGTACAGGG - Intergenic
1068526080 10:58131289-58131311 TTGAACACACTACCTGTAAAAGG - Intergenic
1071045942 10:81377546-81377568 TTGTAGACAACACCAGTAAATGG - Intergenic
1074528817 10:114282785-114282807 ATGCACACAACACTGGTTCAGGG - Intronic
1076613819 10:131743437-131743459 TTGCTCACCACTGCTGTACAAGG + Intergenic
1076822662 10:132947163-132947185 ATGTACACATCACCTGTGCACGG - Intergenic
1081537295 11:44005126-44005148 TTGTACACGACAGCTGTAGAGGG + Intergenic
1081606021 11:44527443-44527465 TTGCACACAGGAGCTGTACTAGG - Intergenic
1082949239 11:58792719-58792741 TTCTATACAGCACCTGTACAGGG - Intergenic
1083377633 11:62238700-62238722 TTGCCCTTAACACCTGCACAGGG - Intergenic
1085897883 11:80661599-80661621 TTGCTCACACCACCTACACAAGG - Intergenic
1087193776 11:95284337-95284359 TTGCAAACCCTACCTGTACAGGG + Intergenic
1088700194 11:112404597-112404619 TTGCAATCAACACCTGTGGAAGG - Intergenic
1090291490 11:125549533-125549555 TTGCACAAAAATCCTGTTCAAGG + Intergenic
1090411588 11:126513223-126513245 TTGCTCCCAACACCAGGACAAGG - Intronic
1091342864 11:134832524-134832546 GTTCACACAAAACCTGCACATGG + Intergenic
1093788030 12:23215125-23215147 TTGCACAGAACACCTGACAATGG - Intergenic
1098566647 12:71944840-71944862 TTCCAGTCAACACGTGTACAGGG - Intronic
1100267920 12:92996001-92996023 TTCTACACCACACCTATACAGGG + Intergenic
1100537742 12:95526993-95527015 GTGCACCCAACACCTGAGCAGGG + Intronic
1104321017 12:127750824-127750846 CTGCACATTACCCCTGTACAAGG - Intergenic
1105549811 13:21382851-21382873 GTACACACAACACATGTATACGG + Intronic
1107067995 13:36237465-36237487 TTGCACACAAAACTTGTACAGGG + Intronic
1107204271 13:37763048-37763070 TTGCACAAAAATCCTGTTCAAGG - Intronic
1107277978 13:38698587-38698609 GTTCACACAACACATGTACTAGG - Intronic
1107502652 13:40996337-40996359 GTCCACACAAAACCTGCACATGG + Intronic
1108463256 13:50689152-50689174 ATTCTCACAACACCTGTTCAAGG + Intronic
1108535354 13:51370920-51370942 TTGCAGACAACACCTGCATGCGG - Intronic
1119905385 14:78297520-78297542 TTGCACAGAACAACGGTAAAAGG + Intronic
1125362324 15:38877214-38877236 GTGCCCACAGCACCTGTAGAAGG + Intergenic
1128668144 15:69553594-69553616 TTTCACCCAACACCTGTAGAAGG + Intergenic
1129372921 15:75109345-75109367 TTGCAGACAGCACCTGGAGAAGG - Intronic
1129785739 15:78308987-78309009 TTGCACCCAGCAACTGTTCAGGG + Intergenic
1133868571 16:9667145-9667167 ATGGAAACAGCACCTGTACAGGG - Exonic
1137892242 16:52174842-52174864 TAACACACACCACCTGTTCATGG + Intergenic
1141024858 16:80536925-80536947 GTGCACAAAACAAATGTACAGGG - Intergenic
1143006501 17:3838786-3838808 TTGCTCACAACAACTGTATGAGG - Intronic
1151828452 17:76536560-76536582 TTGGACACATCACCTCTATAAGG + Intronic
1156057514 18:33025896-33025918 GTTCACACAAAACCTGTGCATGG + Intronic
1156844419 18:41647742-41647764 TTTCACACAACAGCTGGAAATGG + Intergenic
1161581949 19:5085958-5085980 CTGCACACAAGATCTGAACAAGG - Intronic
1166264512 19:41670569-41670591 ATGCACACATCACCTGGGCAGGG - Intronic
927094050 2:19734379-19734401 TTGCCCACAACACGTGTTCTTGG - Intergenic
927272797 2:21231502-21231524 ATGCTCACAACACTTGTACCTGG - Intergenic
927677137 2:25114448-25114470 TTGCACACACCACTTCTCCACGG + Intronic
928437225 2:31262444-31262466 ATGCTCACAACACCTGTATAAGG - Intronic
931472508 2:62553228-62553250 TTCCAAACAACTACTGTACAAGG - Intergenic
933679387 2:85086120-85086142 GTGCACAGAAAACCTGCACATGG - Intergenic
933693898 2:85201325-85201347 TTGCACACACAGACTGTACATGG - Intronic
933891108 2:86770962-86770984 TTTTATACCACACCTGTACACGG + Intronic
940500223 2:154484848-154484870 TTTAACACAGCTCCTGTACATGG + Intergenic
942957448 2:181789920-181789942 TTGGACCCATCACTTGTACAAGG - Intergenic
944736491 2:202571614-202571636 TTGCACACAGCATTTGTACTAGG + Intergenic
1169824280 20:9749486-9749508 TTGTACATAGCACCTGTCCAGGG + Intronic
1173513900 20:43651342-43651364 TTGGCCAGAACACCTATACATGG - Intergenic
1174188252 20:48722136-48722158 GTCCACACAAATCCTGTACATGG + Intronic
1175169315 20:57068987-57069009 TTGCACACATCACTTCTCCAAGG + Intergenic
1175605912 20:60312072-60312094 AAACACACAACACCTGTACCTGG + Intergenic
1175991195 20:62790245-62790267 ATGTACACAACACACGTACATGG - Intergenic
1178081283 21:29068385-29068407 CTCCACAAAACACTTGTACAAGG - Intronic
1181460607 22:23083798-23083820 CGGCACACCACACCTGTTCAAGG + Intronic
1181940339 22:26470887-26470909 TTGTACAGAACAGCTGGACAGGG + Intronic
1182056571 22:27360418-27360440 TTTCACAGAAAACCTGTATATGG - Intergenic
1183133597 22:35864744-35864766 ATGCACACAGCACCAGTTCAGGG + Intronic
1184396009 22:44241248-44241270 GTCCACACAAAACCTGCACATGG - Intergenic
1184899165 22:47433508-47433530 TACTACACAACACCTGCACACGG + Intergenic
955533586 3:59900041-59900063 TTGCCCACAACCCCTGTGCTAGG + Intronic
956706918 3:72007068-72007090 TCGCACTCAACACCTGTGGAAGG - Intergenic
960086851 3:113600670-113600692 TTGCACACAACATCTTCACATGG + Intronic
963026155 3:140921323-140921345 GTCCACACAAAACCTGCACATGG - Intergenic
963843219 3:150129305-150129327 CTGCACACAACAGCTGTTTATGG - Intergenic
965081625 3:164039794-164039816 TTGTACATAACACTTGTATATGG + Intergenic
967258001 3:187612882-187612904 TTGCTCACAACAAATGGACAAGG + Intergenic
970611014 4:17725311-17725333 TTGCACATAACACATCTAAATGG - Intronic
978122965 4:105103598-105103620 TTGCACACAACACCTGTACATGG + Intergenic
981106736 4:140890409-140890431 TAGCACACAACACATGTACAGGG - Intronic
982957338 4:161788588-161788610 TTTGAAACAACACCTGTGCAGGG + Intronic
983167664 4:164497324-164497346 TGGGACACAGCACCTGTGCAGGG - Intergenic
985700195 5:1366902-1366924 GTCCGCACAAAACCTGTACATGG + Intergenic
986035709 5:3935235-3935257 GCTCACACAAAACCTGTACATGG - Intergenic
994307888 5:98228705-98228727 ATGCACACAACACCAGAGCATGG + Intergenic
998150908 5:139756962-139756984 ATCCACACAACAGCTCTACAAGG + Intergenic
998277607 5:140772446-140772468 TAGAACACAAGTCCTGTACATGG + Intergenic
1000805185 5:165781844-165781866 CTGAACACAACACTTGAACAAGG - Intergenic
1001478261 5:172066289-172066311 TTGCAGACAAGACTGGTACAGGG + Intronic
1002682477 5:180978090-180978112 GTGTACACAGCCCCTGTACAGGG - Intergenic
1003731828 6:8833037-8833059 ATCCACACAAAACCTGCACATGG - Intergenic
1004157539 6:13183601-13183623 CTGCACAGAACACCTGATCAGGG + Intronic
1007829867 6:44629914-44629936 CTGCAGACAAGACCTGTAGAAGG - Intergenic
1008683196 6:53896212-53896234 TTCCACATATCACATGTACAAGG + Intronic
1010971501 6:82267661-82267683 TTGGACATCACACCTCTACAAGG - Intergenic
1011764286 6:90603439-90603461 TTGAAAACAAAACCTGTAAAAGG + Intergenic
1012664653 6:101952389-101952411 GTTCACACAAAACCTGTACATGG - Intronic
1012781265 6:103560644-103560666 TTCCACACAAAACCTGCACATGG - Intergenic
1013409521 6:109871733-109871755 TTGACCAGAACACCTGCACATGG - Intergenic
1014486457 6:122004824-122004846 TTACACACAACACCTGATGAGGG + Intergenic
1016968681 6:149742473-149742495 TTGCACACAACACCTGTACATGG + Exonic
1017561785 6:155636145-155636167 TTGAACACAAGTCCTATACATGG - Intergenic
1020707832 7:11567723-11567745 TTGCAAACCACAGCTGTATATGG + Intronic
1024927328 7:54631155-54631177 GTGCACACAGTCCCTGTACAGGG + Intergenic
1027728240 7:81834892-81834914 TTTCACAAAAGACCTTTACACGG + Intergenic
1028702330 7:93794385-93794407 GTCCACACAACAGCTGCACATGG - Intronic
1029360125 7:100082262-100082284 CTGCTCTCATCACCTGTACACGG - Intronic
1032442351 7:131951621-131951643 TTGGCCACAACACCTCCACATGG - Intergenic
1033532543 7:142279741-142279763 TTGGCCACAGCACCTGTGCATGG - Intergenic
1035523189 8:291563-291585 ATGTACAGAACACCTGTAAATGG + Intergenic
1036072065 8:5451831-5451853 TCACACACAAAACCTATACAAGG + Intergenic
1037861053 8:22405901-22405923 TTTCTCACAACACCAGCACAGGG - Intronic
1040098283 8:43471118-43471140 CTGCATACAAGCCCTGTACATGG - Intergenic
1046206355 8:111003186-111003208 GTTCACACAAAACCTGCACATGG + Intergenic
1047547210 8:125829889-125829911 GTCCTCACAACACCTCTACAAGG - Intergenic
1048510627 8:135058922-135058944 GTCCACACAAAACCTGAACATGG + Intergenic
1051563843 9:18473630-18473652 TTGTACAGAACACATTTACAGGG + Intergenic
1052582507 9:30376990-30377012 GTCCACATAAAACCTGTACATGG + Intergenic
1054858894 9:69929773-69929795 TTACACCCAATACCTGTAGATGG - Intergenic
1056343317 9:85662079-85662101 TTGCATACATCAGCAGTACAAGG + Intronic
1057137121 9:92699811-92699833 ATGCACACAAAGACTGTACATGG - Intergenic
1059342155 9:113603416-113603438 TTGATCACAACAACTGTACTAGG - Intergenic
1061182994 9:129036152-129036174 TTGCAAACAACTCCAGAACAAGG + Intergenic
1186799846 X:13081906-13081928 TTGCACACAAACCTTGCACAAGG + Intergenic
1188916538 X:35918591-35918613 TTTCCCACAACACTTTTACAAGG - Intergenic
1189945488 X:46172966-46172988 TCCCACACAAAACCTGTACATGG - Intergenic
1193885463 X:86980476-86980498 CTGCACAAAACACCTCTAGAAGG + Intergenic
1194278712 X:91920291-91920313 TTGCACAGAACATCTATAAATGG - Intronic
1197295023 X:124708145-124708167 GTGCACACATTACATGTACAAGG - Intronic
1197872389 X:131072404-131072426 TTGCACACAAGGACTGCACAAGG - Intronic
1199899140 X:152156064-152156086 TTTCACACAGCTCCTGGACAAGG + Intergenic
1200596197 Y:5143793-5143815 TTGCACAGAACATCTATAAATGG - Intronic