ID: 1016968683

View in Genome Browser
Species Human (GRCh38)
Location 6:149742487-149742509
Sequence TGTACATGGTGCACTGCTAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968677_1016968683 20 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1016968676_1016968683 24 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1016968680_1016968683 15 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968683 Original CRISPR TGTACATGGTGCACTGCTAT AGG Exonic