ID: 1016968683

View in Genome Browser
Species Human (GRCh38)
Location 6:149742487-149742509
Sequence TGTACATGGTGCACTGCTAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968677_1016968683 20 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1016968676_1016968683 24 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1016968680_1016968683 15 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968683 Original CRISPR TGTACATGGTGCACTGCTAT AGG Exonic
903896677 1:26610758-26610780 TGGACATGCTGGTCTGCTATGGG - Intergenic
903972941 1:27130966-27130988 TGGGCATGGGGCACTTCTATGGG - Intronic
907554137 1:55330098-55330120 TGTATAAGCTGCAGTGCTATTGG + Intergenic
907960917 1:59280118-59280140 TATACCTGGTGCTCTGCTAGGGG + Intergenic
908588164 1:65597269-65597291 GGTATATGGAGCACTGCAATGGG - Intronic
908653880 1:66366778-66366800 TTTATATGTTGCAGTGCTATAGG - Intronic
919592273 1:199519767-199519789 GGTACTTGGTGCATTGCTAATGG - Intergenic
1070168905 10:73917788-73917810 TGTACATGGTGGTCTTCTTTAGG + Intronic
1074252029 10:111760677-111760699 TGTACATGGCTCACTGGAATGGG - Intergenic
1075434102 10:122419561-122419583 TGAACCTGGTGCACTGTTCTGGG + Intronic
1082838130 11:57666850-57666872 AGAACATGGGGCATTGCTATTGG + Intergenic
1088692494 11:112339619-112339641 TGTACAGGCTGCCCTGCTGTTGG + Intergenic
1089297486 11:117478810-117478832 TGTAGATGCTGCACTGAGATGGG - Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1093031090 12:14289101-14289123 ATTACATAGTCCACTGCTATGGG + Intergenic
1094609190 12:31977129-31977151 TGTTCATTGTGCCCTGTTATAGG + Intronic
1096410326 12:51372612-51372634 TGTATATGGTGGCCTGCTAGGGG + Intronic
1100989212 12:100234222-100234244 GGTACAGGGACCACTGCTATGGG + Intronic
1104320468 12:127746002-127746024 TGTGCATGTTTCCCTGCTATTGG - Intergenic
1105636746 13:22223010-22223032 TGTGCATGGTGCTCAGCGATGGG - Intergenic
1121058274 14:90879124-90879146 AGCACATGATGCACTGCTCTTGG - Intronic
1124954266 15:34349682-34349704 TGTACATGGTGCTCTTCCAGTGG + Intronic
1129161237 15:73749040-73749062 TGAACCTGGAGCTCTGCTATTGG + Intronic
1141412895 16:83847640-83847662 TGTACCTTGTGAAATGCTATAGG + Intergenic
1141706329 16:85667179-85667201 TCTACAAGGTGCACTGCCAAAGG - Intronic
1145039635 17:19567715-19567737 AGCACATGGGGCACTGCTCTAGG - Intronic
1145416565 17:22718100-22718122 TAGACATGGTGCACTGGTCTAGG - Intergenic
1156304338 18:35862708-35862730 AGAACTTTGTGCACTGCTATTGG - Intergenic
1157098119 18:44705727-44705749 TATACATGGTCCACTGCTTTGGG + Intronic
1159059838 18:63503110-63503132 TGCACATGGAACACTGTTATAGG + Intronic
1159242535 18:65760823-65760845 TGGACATGGTGCACTAGTGTAGG - Intronic
928205410 2:29280088-29280110 TGTACCAGGTGGACTGCTGTGGG + Intronic
933307319 2:80618591-80618613 TGTACATGGTCCTCTACTAAGGG - Intronic
933714607 2:85350866-85350888 TGTACATGGGGTACTCCTTTCGG + Exonic
943264875 2:185716358-185716380 TGAATATGGTGCACCACTATTGG + Intergenic
945144214 2:206719631-206719653 TGTGGATGGTCCACTGCTGTGGG - Intergenic
1170092399 20:12604889-12604911 TGTACTTGGTACATAGCTATTGG - Intergenic
1171519875 20:25767488-25767510 TAGACATGGTGCACTGGTCTAGG - Intronic
1171557044 20:26089005-26089027 TAGACATGGTGCACTGGTCTAGG + Intergenic
1176654013 21:9573777-9573799 TAGACATGGTGCACTGGTCTAGG - Intergenic
951461723 3:22958241-22958263 TGTACAGGGACCACTGCAATGGG - Intergenic
955216591 3:56989401-56989423 TGGAAATGGGGCACTGCTGTGGG - Intronic
962427152 3:135281193-135281215 TAAACATGGTGTACTGCTAGTGG - Intergenic
964371820 3:156008189-156008211 TGAACATGGTGCCATCCTATGGG + Intergenic
979816741 4:125116054-125116076 TTTAAATTGTGCACTGCTCTGGG + Intergenic
995951695 5:117721929-117721951 TGTCCATGATGCACTGTTAGAGG - Intergenic
996389275 5:122942357-122942379 TGTACAGGGTGCTGTGCTACTGG - Intronic
1000646804 5:163769444-163769466 TGTACAGGGTGCAGAGCTATGGG - Intergenic
1003753472 6:9089102-9089124 TGTACACAGAGCACTGCAATTGG + Intergenic
1005146855 6:22701411-22701433 TCTACATGGTCCACTGGTAAAGG + Intergenic
1006529819 6:34642209-34642231 TGTGGATGGTCCGCTGCTATGGG - Intronic
1008157610 6:48035941-48035963 AGTACAGGGAGCACTGCAATGGG - Intronic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1017750910 6:157489831-157489853 TGATCATGGCTCACTGCTATGGG + Intronic
1023744202 7:43307113-43307135 TGTACAAAGTGCCCTGCTATGGG - Intronic
1024100182 7:46024494-46024516 TGACCATGGTTCACTGCTAAAGG + Intergenic
1025280359 7:57622441-57622463 TAGACATGGTGCACTGGTCTAGG - Intergenic
1025304374 7:57843060-57843082 TAGACATGGTGCACTGGTCTAGG + Intergenic
1028453676 7:91015305-91015327 TGTACATTCTTCACTGCTATGGG + Intronic
1029593279 7:101521420-101521442 TGTACAGGGTGCATGGCAATTGG + Intronic
1030659932 7:112207364-112207386 TGTAGATGGTTAACTGCTCTGGG + Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1038003398 8:23409602-23409624 TGTACACTGTACACTGCTGTGGG - Intronic
1040542180 8:48370205-48370227 TGTACACTGTGGCCTGCTATTGG + Intergenic
1042821361 8:72933672-72933694 TGTACATGTTACCCTGCCATTGG + Intronic
1043228961 8:77773924-77773946 GGTGCATGTTGCATTGCTATTGG + Intergenic
1044494477 8:92860415-92860437 TGTACATTTTACACTGCTAAGGG - Intergenic
1057058922 9:91985826-91985848 GGTACATGGTGTGCAGCTATTGG + Intergenic
1057320097 9:94004850-94004872 TGTATGTGATCCACTGCTATGGG - Intergenic
1059854495 9:118381501-118381523 TGTAGAGAGTGCACTCCTATAGG + Intergenic
1060074506 9:120579695-120579717 AGTACATGGCGCAATGCTACTGG + Intronic
1060384333 9:123209540-123209562 TGTACATGGTGAACTTCTTGTGG - Intronic
1203631733 Un_KI270750v1:77229-77251 TAGACATGGTGCACTGGTCTAGG - Intergenic
1186815422 X:13232960-13232982 TGTACTTGGTGGTCTTCTATGGG + Intergenic
1190195607 X:48315662-48315684 TGTACACGGGCCACTGCAATGGG + Intergenic
1190662057 X:52663874-52663896 TGTACACGGGCCACTGCAATGGG + Intronic
1194578863 X:95646384-95646406 TGCACATGGTGCTATGCTAAAGG - Intergenic
1196324462 X:114386113-114386135 TTTACATTTTGCACTGGTATGGG + Intergenic
1198734060 X:139767002-139767024 TGTACATTCTGCACTCCTGTTGG - Intronic
1200957891 Y:8970144-8970166 TGCACATGCTGCACTGGAATGGG + Intergenic