ID: 1016968683 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:149742487-149742509 |
Sequence | TGTACATGGTGCACTGCTAT AGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 80 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 4, 4: 75} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016968677_1016968683 | 20 | Left | 1016968677 | 6:149742444-149742466 | CCTCTCCAACTGTAACGATTTCT | 0: 1 1: 0 2: 0 3: 9 4: 109 |
||
Right | 1016968683 | 6:149742487-149742509 | TGTACATGGTGCACTGCTATAGG | 0: 1 1: 0 2: 0 3: 4 4: 75 |
||||
1016968676_1016968683 | 24 | Left | 1016968676 | 6:149742440-149742462 | CCATCCTCTCCAACTGTAACGAT | 0: 1 1: 0 2: 0 3: 9 4: 120 |
||
Right | 1016968683 | 6:149742487-149742509 | TGTACATGGTGCACTGCTATAGG | 0: 1 1: 0 2: 0 3: 4 4: 75 |
||||
1016968680_1016968683 | 15 | Left | 1016968680 | 6:149742449-149742471 | CCAACTGTAACGATTTCTGGGTT | 0: 1 1: 0 2: 0 3: 5 4: 92 |
||
Right | 1016968683 | 6:149742487-149742509 | TGTACATGGTGCACTGCTATAGG | 0: 1 1: 0 2: 0 3: 4 4: 75 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016968683 | Original CRISPR | TGTACATGGTGCACTGCTAT AGG | Exonic | ||