ID: 1016968684

View in Genome Browser
Species Human (GRCh38)
Location 6:149742491-149742513
Sequence CATGGTGCACTGCTATAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016968680_1016968684 19 Left 1016968680 6:149742449-149742471 CCAACTGTAACGATTTCTGGGTT 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1016968676_1016968684 28 Left 1016968676 6:149742440-149742462 CCATCCTCTCCAACTGTAACGAT 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
1016968677_1016968684 24 Left 1016968677 6:149742444-149742466 CCTCTCCAACTGTAACGATTTCT 0: 1
1: 0
2: 0
3: 9
4: 109
Right 1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016968684 Original CRISPR CATGGTGCACTGCTATAGGA AGG Exonic
906085883 1:43134429-43134451 CATGTTGCACTACAAAAGGAGGG - Intergenic
906166208 1:43688332-43688354 CATGTAGCTCTGCTCTAGGAGGG + Intronic
906383577 1:45348078-45348100 CAAGGTGCCCTGTGATAGGAAGG - Intronic
912131248 1:106603723-106603745 CATGGTGAAAGGCTACAGGAAGG + Intergenic
917593883 1:176507767-176507789 CATTGTGGACTACTAGAGGAGGG + Intronic
924937631 1:248785424-248785446 CATGGAGCACTGCTATATGCTGG - Intergenic
1064806794 10:19144067-19144089 AATGGTGCACTGCTATGACAGGG - Intronic
1065315829 10:24463173-24463195 AATTGTGCAGTGCTGTAGGATGG - Intronic
1066047630 10:31607187-31607209 CCTGGTGCACTGCTAAGGGAGGG + Intergenic
1070819324 10:79345844-79345866 CAGGATGCACTGGTAGAGGAAGG + Intergenic
1071201553 10:83224345-83224367 CATGGTGCATTTCAGTAGGAAGG + Intergenic
1073872301 10:107879602-107879624 CATGCTGCACTGCTAGGGGATGG - Intergenic
1074543531 10:114385342-114385364 CTTGGTGCATTCCTTTAGGATGG - Intronic
1080898483 11:36465846-36465868 GATGGTGCACTGCTATGTCATGG - Intergenic
1082911378 11:58379193-58379215 CATTGTGGACTACTAGAGGATGG + Intergenic
1090440995 11:126725652-126725674 CAGGGTGCACTGCTGCAGGCTGG + Intronic
1096162738 12:49393812-49393834 CATGGTGGCCTGCTATTGAAAGG - Intronic
1100116867 12:91316485-91316507 CCTAGTGCACTGAGATAGGAAGG - Intergenic
1103233541 12:119352497-119352519 GATGTTGCACTGCTAATGGATGG + Intronic
1103528218 12:121581311-121581333 CATGGTGCTCTGGGATAGGTGGG + Intergenic
1106242986 13:27925001-27925023 CAAGGTGGAGTGCTGTAGGAGGG - Exonic
1107619807 13:42215121-42215143 CATGGTACAATGCTATAGTATGG + Intronic
1114499453 14:23157403-23157425 CATGCTGCAAAGCTAAAGGATGG - Intronic
1115936777 14:38561208-38561230 CAAGGTGCTCTCCTATAGGCTGG - Intergenic
1120206392 14:81591439-81591461 CATGGTGCCCTGCTGTGAGAGGG - Intergenic
1127461755 15:59205650-59205672 CATTGTGCACTGTCACAGGAAGG + Intronic
1130400480 15:83547427-83547449 CATGCTGCACTGCTGGGGGATGG + Intronic
1132619318 16:856862-856884 CATCTTGCACAGCTATAGTAGGG + Intronic
1138162054 16:54763436-54763458 CATGGTGCACTGCAGTGGGTCGG + Intergenic
1140638018 16:76939479-76939501 CATGGTGTACTGCAATACAAGGG - Intergenic
1144796819 17:17897049-17897071 CATCATGCCCTGCTAGAGGAAGG + Intronic
1146260392 17:31416768-31416790 CAGGGTCCACTGCTGTAAGAGGG + Intronic
1158860109 18:61583326-61583348 CATGGTGTTCTGCTGTGGGAAGG - Intergenic
1159059839 18:63503114-63503136 CATGGAACACTGTTATAGGCTGG + Intronic
1160301734 18:77687683-77687705 CAATGTGCTCTGCTAGAGGAGGG - Intergenic
1163219218 19:15902585-15902607 CACCCTGCACTGCTACAGGAAGG - Intergenic
1167109958 19:47454372-47454394 TATGGTGCACTGGGAGAGGATGG + Intronic
1168455552 19:56505302-56505324 AATAGTGCACTGTTACAGGATGG + Intergenic
925224884 2:2175147-2175169 CGTGGGGCACTGCTGAAGGAAGG + Intronic
927454529 2:23238089-23238111 CATGGTGCACAGGTCTAGGCAGG + Intergenic
933030666 2:77324902-77324924 CATGGTAGACTGATAAAGGAAGG + Intronic
1180857590 22:19058205-19058227 CATGGTGCCCTGCCATGGGCAGG + Intronic
956887915 3:73578987-73579009 CAAGGTGCACTGATTTTGGAAGG + Intronic
960189763 3:114689205-114689227 CATGCACAACTGCTATAGGATGG - Intronic
961186504 3:124919549-124919571 AATGGTGCATTGCTACACGAGGG + Intronic
967568310 3:190997497-190997519 CATGTTCCACTGATACAGGAAGG - Intergenic
976124640 4:81820312-81820334 CATCTTGCCCTGCAATAGGAAGG - Intronic
976124679 4:81820623-81820645 CATCTTGCCCTGCAATAGGAAGG + Intronic
976889557 4:90030400-90030422 CATGTCGCTCTGCTATTGGAAGG - Intergenic
978003041 4:103580234-103580256 CATGGTGCTCTGCTAAATAAAGG + Intergenic
978122967 4:105103616-105103638 CATGGTGCCCTGCTACACGAAGG + Intergenic
978507844 4:109479565-109479587 CATGGCGCCCTGCTCTAGGTTGG - Intronic
979959758 4:127003664-127003686 CATGGTGCAATTCTACAGGAAGG - Intergenic
986821032 5:11467088-11467110 CCTGGTGCACTGGCTTAGGAAGG - Intronic
988658134 5:33235001-33235023 CATGGGGTGCTGCTATAGGTGGG + Intergenic
989330675 5:40254201-40254223 CGTGCTGTACTACTATAGGAAGG - Intergenic
994257583 5:97617721-97617743 TATGGAGCACTGCTATTGAATGG - Intergenic
1004418432 6:15446350-15446372 CATGAGGTACTGCTTTAGGATGG + Intronic
1007170324 6:39858275-39858297 CAAGGTGCTCTGCTAAAGAAGGG + Intronic
1010004984 6:70986063-70986085 AATGGTGCAACGCAATAGGAGGG - Intergenic
1015394975 6:132723133-132723155 CATTCTACACTGCTTTAGGAGGG - Intronic
1016968684 6:149742491-149742513 CATGGTGCACTGCTATAGGAAGG + Exonic
1023114110 7:36843766-36843788 CATGGTGCATTGGTAGAGGTTGG + Intergenic
1024704881 7:51946182-51946204 GCTGGTGCACAGCTATAGAATGG + Intergenic
1027607089 7:80314030-80314052 CATAGTGATCTGCTATAAGAGGG - Intergenic
1028490784 7:91409272-91409294 CAAGGTGTACTGGTATAGGTTGG - Intergenic
1030902960 7:115147760-115147782 CATGGTGCTCTCCCATAGCAGGG - Intergenic
1033402577 7:141040746-141040768 CATGCTGGAGTGCTGTAGGATGG + Intergenic
1034446639 7:151117130-151117152 CCTGGTGCACCGCTATCTGACGG + Exonic
1037829799 8:22180620-22180642 GATGGAGCACGGCTGTAGGAAGG + Intronic
1040469434 8:47724964-47724986 CCTGGTGCAGGGCTGTAGGAAGG + Intronic
1041128685 8:54672355-54672377 CATAGTGCAGTGCAACAGGAAGG - Intergenic
1041269603 8:56098520-56098542 CATGGGGCACTGATATAGTTTGG + Intergenic
1045844385 8:106616366-106616388 CCTGGTACTCTGCTATAAGAAGG - Intronic
1046963493 8:120135741-120135763 CATGGTGCACTGCTCTATTTAGG + Intronic
1055569972 9:77606808-77606830 CATAGTGCAATGATATAAGATGG + Intronic
1057193066 9:93097925-93097947 CATGGAGCACAGCTCTGGGAGGG + Intronic
1058583360 9:106482202-106482224 CATGATTCACTACTCTAGGAAGG + Intergenic
1059917629 9:119121300-119121322 CAAGGTGCTCTGCTGTAGCAGGG - Intergenic
1062583499 9:137238383-137238405 CAAGGTGCCCTGCTGCAGGATGG - Intergenic
1189238234 X:39505382-39505404 CATGGTTCACTGCTCTATAATGG + Intergenic
1192759468 X:74081128-74081150 CATGCTGCACTGCCACAGGGTGG + Intergenic
1198955622 X:142126260-142126282 CATGCAGCAGTGCTGTAGGAAGG + Intergenic