ID: 1016969758

View in Genome Browser
Species Human (GRCh38)
Location 6:149750554-149750576
Sequence CCCCGCACGGAGCTTTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016969758_1016969765 24 Left 1016969758 6:149750554-149750576 CCAGTGGAAAGCTCCGTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1016969765 6:149750601-149750623 TCCTGAGAGACTTGTATTTCAGG 0: 1
1: 0
2: 1
3: 14
4: 363
1016969758_1016969763 -7 Left 1016969758 6:149750554-149750576 CCAGTGGAAAGCTCCGTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1016969763 6:149750570-149750592 TGCGGGGCGGAGAAAGAACAGGG No data
1016969758_1016969764 -6 Left 1016969758 6:149750554-149750576 CCAGTGGAAAGCTCCGTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1016969764 6:149750571-149750593 GCGGGGCGGAGAAAGAACAGGGG 0: 1
1: 0
2: 0
3: 10
4: 209
1016969758_1016969762 -8 Left 1016969758 6:149750554-149750576 CCAGTGGAAAGCTCCGTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1016969762 6:149750569-149750591 GTGCGGGGCGGAGAAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016969758 Original CRISPR CCCCGCACGGAGCTTTCCAC TGG (reversed) Intronic
900798663 1:4724592-4724614 GCCTGCATGGTGCTTTCCACCGG + Intronic
905257605 1:36694916-36694938 CCCAGCATGGGGCCTTCCACAGG - Intergenic
905921397 1:41721830-41721852 CCCCACACGGTGCTGTCCATCGG + Intronic
916757976 1:167791391-167791413 CTCCTCAAGGAGCTTGCCACAGG + Exonic
917906161 1:179588775-179588797 CCCTGCACGGAGCTGTCCCTGGG + Intergenic
1069757137 10:70780219-70780241 CCCTGCACGCAGCCTTGCACAGG - Intronic
1070934121 10:80280421-80280443 TCCTCCATGGAGCTTTCCACTGG + Intronic
1075682631 10:124343465-124343487 CCACGCACAGAGCTGTGCACAGG + Intergenic
1077265661 11:1648320-1648342 GCCCGCACTGAGCTTCTCACCGG + Intergenic
1081026321 11:38019382-38019404 GCCCCCATGGAGCTCTCCACTGG - Intergenic
1095206173 12:39442936-39442958 ACCCGCACGGAGCTCTCGTCCGG + Exonic
1095851421 12:46811512-46811534 CCCTGCACTGACCTTTCCAGTGG - Intronic
1101089916 12:101274713-101274735 CTACACACTGAGCTTTCCACAGG + Intergenic
1105038191 12:132941706-132941728 CCCCGCAGGGCACTTCCCACGGG + Intronic
1105705833 13:22966871-22966893 CCCTGCAGGGAGCTGTCCAATGG + Intergenic
1105858736 13:24391857-24391879 CCCTGCAGGGAGCTGTCCAATGG + Intergenic
1132222371 15:100114562-100114584 CCACGCTCGGGGCTTTGCACAGG - Intronic
1132957547 16:2603506-2603528 CCCCGCCCCGAGCCTGCCACGGG - Intergenic
1138026476 16:53526108-53526130 CCCCGCAAGGTGAATTCCACTGG - Intergenic
1143590992 17:7885636-7885658 CCCCGCACGGAGCAGCCGACGGG + Intronic
1146286144 17:31575300-31575322 CCCACCAGGGAGCTTTCCATGGG + Intronic
1149994315 17:61399068-61399090 CCCCGCCCTGAGCTTTCCAGCGG - Intergenic
1152552076 17:81034968-81034990 CCCCGCACCGCCCTTTCCATTGG - Intergenic
1155201067 18:23518122-23518144 CCCAGCACAGAGTTTACCACTGG + Intronic
1155998479 18:32358159-32358181 CCCCACACGGAGGCTTTCACAGG + Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
926475517 2:13316535-13316557 CCCTGCACAGAACTTTCCAATGG + Intergenic
937687948 2:124719597-124719619 CCTTGCACAGAGATTTCCACTGG + Intronic
948199619 2:236120253-236120275 CCCTGCACGGAGCTGTCCCTGGG + Exonic
1171426533 20:25052031-25052053 CCCCACATGGAGCTTTCTTCAGG - Intronic
1172914506 20:38433782-38433804 CCCTGCACTGAGCCTTGCACAGG + Intergenic
1175172851 20:57092227-57092249 CCCCGCACGCTTCTTGCCACCGG + Intergenic
1175975588 20:62708927-62708949 CCCGGCTCGGCGCTTGCCACGGG - Exonic
1178580250 21:33832050-33832072 CCCCGCAGGAAGCCTTCCCCTGG - Intronic
1181083605 22:20429326-20429348 CCCCGCAGGGAGCTTTCGCTTGG - Exonic
961701925 3:128751180-128751202 CCCCACACAGAGCTCTCCACAGG + Intronic
962240485 3:133747253-133747275 CCCCGCACAGAGCACTTCACAGG + Intronic
966711999 3:182980677-182980699 CCCCGCGCGGGGCTTCCCCCGGG + Intronic
968518284 4:1023870-1023892 AGCCGCACGGAGCTACCCACGGG - Exonic
996384353 5:122895392-122895414 AACAGCACTGAGCTTTCCACTGG - Intronic
999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG + Intronic
1016969758 6:149750554-149750576 CCCCGCACGGAGCTTTCCACTGG - Intronic
1018022504 6:159775028-159775050 CCCCACACAGAGCATTGCACAGG + Intronic
1029524659 7:101087581-101087603 CCCGGCACGCAGGTCTCCACAGG - Exonic
1030048952 7:105521732-105521754 CCCCGCGCGGCGCTGTCCCCCGG - Intronic
1034416336 7:150966143-150966165 CCCCACACACAGCTTGCCACAGG + Intronic
1056773267 9:89495139-89495161 CCCCCCACTGAGGTTTGCACAGG + Intronic
1057208256 9:93185625-93185647 GCCCGCAGGGGGCTTTCCGCAGG + Intronic
1059226941 9:112681154-112681176 CCCCTCACTGGGCATTCCACAGG + Intergenic
1061918448 9:133769337-133769359 CCCAGCACGGAGCTGCCCACTGG - Intronic
1187963121 X:24585230-24585252 CCCTGCACTGAGCTTTCTAAAGG - Intronic
1190131079 X:47749404-47749426 CCCCGCATGGCTCTCTCCACAGG - Intergenic
1200210431 X:154344598-154344620 TCCTGGAAGGAGCTTTCCACTGG + Intergenic
1200220421 X:154387494-154387516 TCCTGGAAGGAGCTTTCCACTGG - Intergenic