ID: 1016972705

View in Genome Browser
Species Human (GRCh38)
Location 6:149779339-149779361
Sequence CCTTTTAAGCAGTTTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 3, 1: 5, 2: 13, 3: 23, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016972705_1016972712 13 Left 1016972705 6:149779339-149779361 CCTGCCACAAACTGCTTAAAAGG 0: 3
1: 5
2: 13
3: 23
4: 252
Right 1016972712 6:149779375-149779397 TGTTCAGGGATCAGACTTTCTGG No data
1016972705_1016972708 -2 Left 1016972705 6:149779339-149779361 CCTGCCACAAACTGCTTAAAAGG 0: 3
1: 5
2: 13
3: 23
4: 252
Right 1016972708 6:149779360-149779382 GGTGATTGATCCCTTTGTTCAGG No data
1016972705_1016972709 -1 Left 1016972705 6:149779339-149779361 CCTGCCACAAACTGCTTAAAAGG 0: 3
1: 5
2: 13
3: 23
4: 252
Right 1016972709 6:149779361-149779383 GTGATTGATCCCTTTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016972705 Original CRISPR CCTTTTAAGCAGTTTGTGGC AGG (reversed) Intronic
900279377 1:1856266-1856288 CCTATTCAGGAGGTTGTGGCAGG - Intronic
900817897 1:4863915-4863937 CATTTAAAGCAGTATGTGGGGGG - Intergenic
903486986 1:23697055-23697077 CCTTTTGAGCACTACGTGGCTGG - Intergenic
903512675 1:23888090-23888112 CCCTTTAAGCATTTTGAGGTGGG - Intronic
904237904 1:29125720-29125742 GGTTTTAAGCAGGTAGTGGCAGG - Intergenic
906184004 1:43846578-43846600 CTTTTTAACCTGTTTGTGTCAGG + Intronic
908757274 1:67480364-67480386 CCATGTAAGAAGCTTGTGGCAGG + Intergenic
908996406 1:70161394-70161416 CTTTTTAAGAAATTTTTGGCCGG + Intronic
911208245 1:95114537-95114559 CATTTAAAACAGTTTTTGGCTGG + Intergenic
912399097 1:109373644-109373666 GCTTTTAAGCATTTTTAGGCGGG - Intronic
913080954 1:115386472-115386494 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
913099821 1:115552682-115552704 CCTCTTAAGAAGTTTGCAGCTGG - Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
920806156 1:209235828-209235850 CAATTTAAGCTGGTTGTGGCTGG + Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
923464146 1:234233084-234233106 CCTCTTTAGCAATTTCTGGCTGG - Intronic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065230778 10:23596234-23596256 CATTTAAAGCAGTATGTGGTGGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067005248 10:42654821-42654843 CATTTTAAGCAATCAGTGGCCGG - Intergenic
1069482861 10:68799523-68799545 ACTTTTAAAGAGTTCGTGGCTGG + Intergenic
1074000773 10:109370223-109370245 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1075828010 10:125377146-125377168 CCTTCTAAGCCCTTTGTGGGTGG + Intergenic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1077759336 11:5074575-5074597 GCTTTTAATCAGTGTGTGGTGGG - Intergenic
1078071281 11:8113199-8113221 TCTTTTAAGCATTCAGTGGCTGG - Intronic
1078780261 11:14431912-14431934 CCTTTAAAGCAGTGTGTAGAGGG + Intergenic
1081151177 11:39634541-39634563 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1082136235 11:48552507-48552529 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086691545 11:89792734-89792756 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087601831 11:100327181-100327203 GCTTTTAAGCAGGATGAGGCTGG - Intronic
1088549892 11:111002023-111002045 CCTTGGAAGCATGTTGTGGCTGG - Intergenic
1089211500 11:116806846-116806868 CCTTTTACAGAGTTTGAGGCTGG - Intergenic
1089714112 11:120339705-120339727 TCTGTTTTGCAGTTTGTGGCAGG + Intronic
1090644224 11:128754661-128754683 GTTTTTGAGCAGATTGTGGCAGG + Intronic
1091745665 12:2991359-2991381 TCTTTTAAGTAGTTTGTTTCAGG + Intronic
1091906807 12:4195668-4195690 CTTATTTATCAGTTTGTGGCTGG - Intergenic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1092532657 12:9358144-9358166 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1092536442 12:9392516-9392538 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094174620 12:27528771-27528793 CTTTTTAGGCAGTTTGGGGGAGG + Intronic
1094749302 12:33387039-33387061 CCTGGTAAGAAATTTGTGGCAGG + Intronic
1095369186 12:41446057-41446079 CCTTTTAAGCTTTTTGTTGAGGG - Intronic
1096524294 12:52201315-52201337 GCTTTGAAGCAGTGTGCGGCAGG - Intergenic
1096659360 12:53114422-53114444 GATTTTAAACAGTTTCTGGCTGG + Intronic
1097923359 12:65101485-65101507 CATTTTAGGCAGTTTTTGCCTGG - Intronic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1098993629 12:77093601-77093623 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1100525355 12:95413992-95414014 TCTTTTAAGAAATTTCTGGCTGG - Intergenic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102683947 12:114709707-114709729 CCTTTTAAGAAATCTGGGGCTGG - Intergenic
1105989310 13:25602620-25602642 GCATTTGAGCAGTGTGTGGCTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107912366 13:45117532-45117554 CCTATTAAGCAGGTTGGGGCTGG + Intergenic
1108897963 13:55359086-55359108 TGTTTTAAGCATTTTCTGGCAGG + Intergenic
1111506341 13:89194611-89194633 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
1113283429 13:108816679-108816701 CCTTTTATGCACCTTGAGGCGGG - Intronic
1113575189 13:111390315-111390337 ACTTTGGAGCAGTTTCTGGCTGG + Intergenic
1114030031 14:18570231-18570253 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1114161876 14:20177454-20177476 CCTTTTATGCACCTTGAGGCGGG + Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114248997 14:20941343-20941365 CCTTTTAGGTTTTTTGTGGCTGG + Intergenic
1114708851 14:24756387-24756409 CATTTAAAGCAGTGTGTGGAAGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115388065 14:32820907-32820929 CATTTTAAGCAGCTTTTGCCTGG - Intronic
1115624609 14:35177896-35177918 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1116483042 14:45414396-45414418 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
1116630126 14:47320218-47320240 ACTATTAAACAATTTGTGGCTGG + Intronic
1116682981 14:47999021-47999043 CCTTGTAACCAGTTTTTGGGTGG + Intergenic
1117529206 14:56642498-56642520 CATTTAAAGCAGTGTGTGGAGGG + Intronic
1118006647 14:61569414-61569436 CCTTGTAAGCTGTATCTGGCTGG - Intronic
1120566303 14:86062575-86062597 CCTTTTAGGAAGTTTGCGGAAGG + Intergenic
1121321397 14:92993762-92993784 CTTTTTAAGCACTTTGGGGCAGG - Intronic
1121845883 14:97171680-97171702 CATTTAAAGCAGTGTGTGGGAGG - Intergenic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1124935767 15:34168928-34168950 CATTTAAAGCAGTGTGTAGCCGG + Intronic
1125331179 15:38583696-38583718 CATTTAAAGCAGTGTGTAGCCGG + Intergenic
1125556572 15:40590732-40590754 CGTTTTACGCAGTCAGTGGCCGG + Intergenic
1126239748 15:46427900-46427922 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
1128019037 15:64374243-64374265 CTTCTTAAAAAGTTTGTGGCCGG + Intronic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1129042645 15:72703151-72703173 CCGTGTCAGCAGTTTCTGGCTGG + Intronic
1129127061 15:73450975-73450997 CCTTTAAAGCAGTGTGTAGAGGG + Intronic
1129604728 15:77019312-77019334 CCTTTCAAGAAGTTGGAGGCCGG - Intronic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131555299 15:93393109-93393131 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1138782386 16:59804817-59804839 AATTTTAAGCATTTTATGGCAGG - Intergenic
1139667392 16:68467211-68467233 CCTTTCAAGAAGTTTGTGAGGGG - Intergenic
1147527788 17:41242872-41242894 CCTTTAAAGCAGTGTGTAGAGGG + Intronic
1147940229 17:44041635-44041657 TCTTTTGATCAGTTTGTGGATGG - Intronic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1153961255 18:10141941-10141963 TCTTTTAGACAATTTGTGGCGGG - Intergenic
1156531141 18:37816423-37816445 ACTTTTAACCCATTTGTGGCTGG - Intergenic
1156772587 18:40747656-40747678 ACTTTTTAGAAGTTTGTGGGTGG + Intergenic
1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG + Intronic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1159213364 18:65359032-65359054 CCTATTAAGCAATTTGTGTAGGG - Intergenic
1160260387 18:77288498-77288520 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1160558521 18:79741296-79741318 CCTTTTATGCTTTTGGTGGCCGG + Intronic
1162628763 19:11908661-11908683 CATTTAAAGCAGTTTGTAGAGGG + Intronic
1164003529 19:21129125-21129147 CCCTTTAAGCATTTTGAGGTGGG - Intergenic
1164081339 19:21864021-21864043 GCTTTTAGGCATTTTGTGGGTGG + Intergenic
1164091186 19:21953986-21954008 CATTTTAAGCAGTGTGTAGAGGG - Intronic
1164142372 19:22484250-22484272 ACTTTTAAGCGTTTTGTGGTGGG + Intronic
1164203270 19:23036128-23036150 CCTTTTAAGCAGTCAGCAGCCGG + Intergenic
1164248354 19:23454899-23454921 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1166138477 19:40791927-40791949 CCTGTCAAGAAGTTTGGGGCCGG - Intronic
1166156461 19:40915658-40915680 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1168441263 19:56369155-56369177 TCTTTTAAGCACTGTGTGGTGGG + Intergenic
925187718 2:1860600-1860622 CATTTTATGCAGCTTGTTGCAGG + Intronic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926395722 2:12440480-12440502 CCTTTTAATCATTTTGTTGATGG - Intergenic
926553636 2:14331181-14331203 CCTTGTAAGAACTTTGGGGCAGG - Intergenic
926999425 2:18777408-18777430 GCTTTTAAGTGGTTTGAGGCTGG - Intergenic
929039141 2:37726127-37726149 CATTTAAAGCAGTGTGTGGAGGG + Intronic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
930295212 2:49545567-49545589 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
930860065 2:56062808-56062830 CATTTAAAGCAGTATGTGGAGGG - Intergenic
931558377 2:63530352-63530374 CATTTAAAGCAGTGTGTAGCAGG - Intronic
931971516 2:67591896-67591918 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
935249192 2:101246726-101246748 CCTCTTAGTCATTTTGTGGCAGG - Intronic
935808842 2:106775470-106775492 CCTTCTAAATAGTGTGTGGCTGG + Intergenic
935822894 2:106912162-106912184 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
936384566 2:112017413-112017435 CCTTTCAAGGAGTTTGAGACTGG + Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936727101 2:115332576-115332598 CATTTAAAGCAGTGTGTAGCGGG - Intronic
939193123 2:138940082-138940104 CATTTAAAGCAGTGTGTTGCAGG - Intergenic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
941865176 2:170326892-170326914 CCTTTGAAGCAGATTGGTGCTGG + Intronic
942771586 2:179527111-179527133 GCTTTTAAGTATTTTGAGGCTGG + Intronic
942854545 2:180529865-180529887 CATTTCAAGCAGTGTGTAGCGGG - Intergenic
942958458 2:181801701-181801723 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
943929712 2:193834020-193834042 CCTTTAAAGCAGTATGTAGAGGG - Intergenic
944051648 2:195476700-195476722 CCTTTCCAGCAGTTTCTGGAGGG + Intergenic
945161588 2:206897360-206897382 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
945208774 2:207360428-207360450 CCTCTGATGAAGTTTGTGGCGGG - Intergenic
945338000 2:208615733-208615755 CCTTTTAACCATTTTGAGGTGGG + Intronic
946294107 2:218769811-218769833 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
948196574 2:236101230-236101252 CCTTTTAATCTGCTTGTGGTGGG - Intronic
948448185 2:238050086-238050108 CATTTTAAGAAGTTCTTGGCTGG - Intronic
1168841151 20:910956-910978 CTTTCTAAGCAGTTTGGGACTGG - Intronic
1170204516 20:13784286-13784308 CCTTTTAATCATTTTGGGGGGGG - Intronic
1170494351 20:16910580-16910602 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1170495716 20:16923020-16923042 CCTCTCAAGTAGTTTGAGGCTGG + Intergenic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1170905493 20:20512436-20512458 TCTTTTTATCAGTTTGTGGTTGG - Intronic
1172157067 20:32834520-32834542 CCTTTTAAGCCATTTTTGGGGGG + Intronic
1175071721 20:56339755-56339777 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1175503257 20:59465115-59465137 CCTTTATAGCAGTGTGTGGAGGG + Intergenic
1175961478 20:62639002-62639024 CCTTTGGAGCAGGGTGTGGCTGG - Intergenic
1176346111 21:5749296-5749318 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176352925 21:5869880-5869902 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176498716 21:7575159-7575181 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1176540432 21:8147366-8147388 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176559383 21:8330411-8330433 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1177682272 21:24386875-24386897 CTTTTTAAGCATTTTGCAGCAGG + Intergenic
1178775784 21:35549048-35549070 CCCATTAAGTAGTTTGTGGGTGG + Intronic
1180454146 22:15497281-15497303 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1183625863 22:39001177-39001199 CCTTAAAAACACTTTGTGGCCGG - Intergenic
1184701865 22:46180651-46180673 CCTTTTACGCATCTTGAGGCAGG - Intronic
1203245375 22_KI270733v1_random:63793-63815 CCTTTTAAGCATTTCATGGGTGG + Intergenic
949587583 3:5456967-5456989 GCTTTTAAGAAAATTGTGGCTGG - Intergenic
949600575 3:5593951-5593973 CCTTTAAAGCAGTGTGTAGAGGG - Intergenic
951120795 3:18925370-18925392 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
952203706 3:31157844-31157866 CTTTTTATGCACTTTGTGCCAGG - Intergenic
953492099 3:43361298-43361320 CCTTGTAAGCCGTTTGCTGCAGG - Intronic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
955809677 3:62774219-62774241 CCTTTTAAGAGCTTTGTGGCCGG - Intronic
957469518 3:80640209-80640231 CATTTTAACTATTTTGTGGCTGG - Intergenic
957972747 3:87404150-87404172 CCTTTAAAGCAGTGTGTAGAGGG + Intergenic
960079363 3:113524900-113524922 CCTTTACAGAAGTTTGTGGGTGG + Intergenic
962913822 3:139880599-139880621 CATTTCAAGCAGTTTGTAGAGGG - Intergenic
963792602 3:149599590-149599612 CCATTTAAGTAGTTTGAGACTGG - Intronic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
971643343 4:29163691-29163713 TTTTCTAAGCACTTTGTGGCAGG + Intergenic
972914574 4:43859968-43859990 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
974284350 4:59844787-59844809 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
974954530 4:68621746-68621768 CCTTTAAAGCAGTGTGTAGAAGG + Intronic
975219196 4:71794809-71794831 CATTTAAAGCAGTATGTAGCGGG - Intronic
976263349 4:83167033-83167055 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
976760331 4:88541936-88541958 CATTTAAAGCAGTGTGTGGAGGG + Intronic
979326293 4:119383799-119383821 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
980188110 4:129488533-129488555 CCTTTTCAGCAGTTCCTAGCTGG + Intergenic
980392361 4:132163157-132163179 CCTTTTAAGCTCTTTAAGGCGGG - Intergenic
980864808 4:138542376-138542398 CCTTTTAAGCTCCTTGTGGGAGG + Intergenic
981814576 4:148815883-148815905 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
981879704 4:149594607-149594629 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
982509994 4:156270270-156270292 TTTTTTAGGCAGTTTGGGGCTGG + Intergenic
982822739 4:159964350-159964372 GATTTTAAGCAATTTGTGCCTGG - Intergenic
983244155 4:165268464-165268486 CATTTAAAGCAGTGTGTAGCGGG - Intronic
983694156 4:170508240-170508262 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
984136990 4:175953462-175953484 CCTGTAAAGCAGTGTATGGCAGG + Intronic
989623259 5:43405486-43405508 CATTTTAAGCAGTGTGTAGGGGG + Intronic
991199734 5:63978048-63978070 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
991553473 5:67869120-67869142 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
993163259 5:84317100-84317122 CCTTTAAAGCAGTGTGTAGAGGG + Intronic
994626915 5:102231724-102231746 CCTTTTAAGGACTTTGCAGCTGG + Intergenic
998685110 5:144515695-144515717 CATTTAAAGCAGTGTGTAGCAGG - Intergenic
1001212436 5:169822608-169822630 CCTTTAAAGCAGTGTGTAGAGGG + Intronic
1003487972 6:6595872-6595894 CCTATTCAGCAGTGTGTGGAGGG + Intronic
1006411190 6:33874589-33874611 CCTTGTAAGCAGATTCTGTCAGG + Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1010463546 6:76140933-76140955 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1011015944 6:82755744-82755766 CCTTTGAAGCAGTGTGTAGAGGG - Intergenic
1011291842 6:85785234-85785256 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG + Intergenic
1014907388 6:127046236-127046258 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1015207156 6:130652793-130652815 CCATTTAAGATCTTTGTGGCTGG - Intergenic
1015506983 6:133998835-133998857 TCCTTTAAACATTTTGTGGCTGG - Intronic
1016655373 6:146512806-146512828 CATTTAAAGCAGTGTGTAGCGGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018330018 6:162717278-162717300 CCTTTTAGTCACTTTGGGGCTGG + Intronic
1018634216 6:165846669-165846691 TCCTTTAAGCGGTTTGTGGAAGG + Intronic
1019975878 7:4581075-4581097 CATTTTATGCAGTTTCTGGGGGG - Intergenic
1022352484 7:29578910-29578932 CCATACAAGAAGTTTGTGGCAGG + Intergenic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1023718874 7:43072595-43072617 CTTTTTAAGCAGCCAGTGGCCGG + Intergenic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1028369325 7:90072942-90072964 CATTTAAAGCAGTGTGTAGCGGG + Intergenic
1028509451 7:91607741-91607763 CCTGTTAAGGAGTTGGTTGCTGG - Intergenic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1031590995 7:123592436-123592458 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1032180631 7:129673841-129673863 TTTTTTAAGCTGTTTTTGGCTGG + Intronic
1032661973 7:133994100-133994122 CCTAGTTAGCTGTTTGTGGCAGG - Intronic
1032718022 7:134527567-134527589 CTTCTTAAGCAGCCTGTGGCCGG + Intergenic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1032958499 7:137001645-137001667 CCTTCTCAGCAGGTTGTGGGGGG + Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1037487245 8:19359024-19359046 CCTTTTCAGCAGTGTTTTGCTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1041340074 8:56835630-56835652 CATTTAAAGAAGTTTGTGGGGGG - Intergenic
1043845117 8:85154269-85154291 CATTTAAAGCAGTTTGTAGAGGG + Intergenic
1045070880 8:98503553-98503575 CATTTAAAGCAGTTTGTAGAGGG - Intronic
1045462163 8:102434603-102434625 CATTTAAAGAAGTTTGTAGCAGG - Intergenic
1046038054 8:108867856-108867878 CTTTTTAGGAAGCTTGTGGCTGG - Intergenic
1046186745 8:110731792-110731814 CCTTTTAAGAAGTTTGGGATGGG - Intergenic
1047028276 8:120848538-120848560 CCTGATGAGCAGTTTGTTGCTGG - Intergenic
1048713720 8:137243352-137243374 CATTTAAAGTAGTTTGTAGCGGG + Intergenic
1050082926 9:1934225-1934247 CATTTAAAGCAGTGTGTGGGGGG - Intergenic
1055002805 9:71472524-71472546 CTTTTTAAGCATTTTGAGGTGGG + Intergenic
1055338426 9:75256846-75256868 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1055823545 9:80297355-80297377 GCTTTTACACAGTTTGTGGGAGG + Intergenic
1055979067 9:81983733-81983755 CATTTTAAGCAGCCTGTGGGAGG - Intergenic
1056149141 9:83766842-83766864 CCTTTTAAACACCTGGTGGCTGG + Intronic
1056979987 9:91300756-91300778 TGTTTTAAGTAGTTTGGGGCTGG - Intronic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1058506448 9:105670845-105670867 GTTTTTAAGCAGTATGTGGGAGG + Intergenic
1059122164 9:111650790-111650812 CTTCTTAAGCAGGTTTTGGCTGG - Intronic
1059379718 9:113913597-113913619 ACTTTTCAGCAGTTTATGCCAGG + Intronic
1059844700 9:118262051-118262073 CCTTTTAGGCAGTTTATTCCCGG + Intergenic
1203461712 Un_GL000220v1:46865-46887 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186520755 X:10204796-10204818 CCTTTTTAGGGGTTTGCGGCTGG + Intronic
1186883010 X:13885399-13885421 CCTTTTAATCAGTTTGCCCCTGG + Intronic
1186950982 X:14624502-14624524 CATTTAAAGCAGTGTGTGGAGGG - Intronic
1188617228 X:32173122-32173144 CATTTTCAGCAGCATGTGGCAGG + Intronic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1191117393 X:56866052-56866074 CCATTTCTGCAGTTTGTGTCTGG - Intergenic
1191121420 X:56909987-56910009 CATTTAAAGCAGTTTGTAGTGGG - Intergenic
1191882157 X:65853782-65853804 CCTTTAAAGCAGTGTGTAGAGGG - Intergenic
1191956497 X:66647981-66648003 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1192288824 X:69769421-69769443 CCTGTTAAGCAGTATGTTGTTGG + Intronic
1192327791 X:70147993-70148015 CTTTTCAAGCATTTTGAGGCTGG + Intronic
1193204156 X:78727977-78727999 GCTCTGAAGCAGTTAGTGGCAGG + Intergenic
1195580005 X:106490965-106490987 CATTTAAAGCAGTTTGTAGAGGG - Intergenic
1195861351 X:109386667-109386689 CCTTTTAAGTACTTTGTGCTTGG - Intronic
1196575122 X:117308023-117308045 CCTTTAAAGCAGTGTGTAGAGGG + Intergenic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1198421439 X:136473363-136473385 TCTTCTAAGCAGTTTAGGGCTGG + Intergenic
1198955258 X:142122289-142122311 CATTTAAAGCAGTGTGTGGAGGG - Intergenic
1199998926 X:153046534-153046556 CCACTAAAGCAGTGTGTGGCTGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201574310 Y:15445616-15445638 TCTTTTGAGCAGTGTCTGGCAGG - Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1201684543 Y:16686172-16686194 CATTTAAAGCAGTGTGTGGAGGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic