ID: 1016974483

View in Genome Browser
Species Human (GRCh38)
Location 6:149793633-149793655
Sequence CTCCCTGAAGACAGAAGTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016974483_1016974485 27 Left 1016974483 6:149793633-149793655 CCAACACTTCTGTCTTCAGGGAG 0: 1
1: 0
2: 0
3: 25
4: 224
Right 1016974485 6:149793683-149793705 AACTTTAAAAATTTCTTCAGAGG 0: 1
1: 1
2: 10
3: 66
4: 703
1016974483_1016974484 -8 Left 1016974483 6:149793633-149793655 CCAACACTTCTGTCTTCAGGGAG 0: 1
1: 0
2: 0
3: 25
4: 224
Right 1016974484 6:149793648-149793670 TCAGGGAGAGTACAGCTTGTTGG 0: 1
1: 0
2: 2
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016974483 Original CRISPR CTCCCTGAAGACAGAAGTGT TGG (reversed) Exonic
900129982 1:1083253-1083275 ATCCCCGAAGACAGAGATGTGGG + Intronic
901426769 1:9186804-9186826 CCCCCTGCAGACAGAACTGCAGG + Intergenic
901736939 1:11318685-11318707 TTCCATGAAGACAGAACTGTGGG - Intergenic
902986913 1:20160451-20160473 CTCCCTGAAGACAGAGTTCCTGG - Intergenic
904156687 1:28489524-28489546 CTCCCTGAAAACAGAAAAATTGG - Intronic
905036292 1:34920057-34920079 CTTCCTGAAGCCAGATGTGGTGG - Intronic
906371814 1:45260302-45260324 CTCCCTGAAGATGGAATTTTAGG - Intronic
907569492 1:55469821-55469843 CTCCTTGAAGAAAGGAGTGAGGG - Intergenic
908709136 1:66995487-66995509 CTCTATGAAGACAGAGGTTTTGG - Intergenic
909044462 1:70692042-70692064 AACCCTGATGACAGAAGTTTTGG + Intergenic
909080228 1:71101975-71101997 ATCCCTTAAGGCAGTAGTGTGGG + Intergenic
909329032 1:74390230-74390252 CTCTCTGATGAAAGAAGTCTGGG + Intronic
911140174 1:94492729-94492751 CTGCATAAAGACAGAAGTGAGGG - Intronic
913232717 1:116755159-116755181 CCACCTGAAGACAGAGTTGTAGG - Intronic
914955637 1:152159503-152159525 GTCCCAAAAGACAGAGGTGTTGG + Intergenic
918529260 1:185500123-185500145 TTTCCTGAAGTCATAAGTGTGGG + Intergenic
919477168 1:198043231-198043253 CTTCATGAAGACTGAAGTTTGGG + Intergenic
920048055 1:203146288-203146310 CTCCCTGAAGACAGTGGCGAAGG - Intronic
920205937 1:204292320-204292342 ATCCCTGAAGCTGGAAGTGTTGG + Intronic
922114511 1:222598763-222598785 ATCCCTTTAGACAGAACTGTAGG - Intergenic
922613207 1:226944956-226944978 CTTTCTGAAGACAGCAGGGTTGG + Intronic
923574351 1:235144325-235144347 CTGCCTGAGGACAGAGGTGGAGG + Intronic
1063330185 10:5150963-5150985 CTCCCTGAAGACTCAGGGGTTGG + Intergenic
1063513281 10:6668389-6668411 CTCCCTGAAGAAGCAAGTGCTGG - Intergenic
1064113929 10:12561524-12561546 CTCCCAGAATACGAAAGTGTAGG - Intronic
1065424252 10:25582536-25582558 CTCTCTGAGGCCAGAACTGTCGG - Intronic
1067029471 10:42870701-42870723 TTCCCTGAAGGCATCAGTGTGGG - Intergenic
1068856729 10:61805507-61805529 CTCTCAGTAGACAGAACTGTAGG + Intergenic
1069705485 10:70456699-70456721 CTCCCTGAGGGCAGAGGTGGGGG + Intergenic
1070848945 10:79546980-79547002 CTCCCTGAAAACAGCAGACTTGG - Intergenic
1070874817 10:79793171-79793193 CTCCATGAGGACAGAAATTTTGG + Intergenic
1070924847 10:80213215-80213237 CTCCCTGAAAACAGCAGACTTGG + Intergenic
1073211533 10:101807171-101807193 CTTCCTGAACAAGGAAGTGTGGG + Intronic
1073924672 10:108501896-108501918 TTCCCTGAAAACAGAACAGTAGG - Intergenic
1074084353 10:110196443-110196465 CTCCCTGAAGGCAGAACTTTGGG + Intergenic
1074637517 10:115337806-115337828 CTCCCTGATGCCAAAAATGTTGG - Intronic
1074757139 10:116632376-116632398 CTCCCTGAAAAGAGAGGTTTTGG + Intronic
1076014133 10:127014197-127014219 ATCCCTGAACCCAGAGGTGTGGG + Intronic
1076672838 10:132132676-132132698 CTGCCTGAAGACAGCTGTGCGGG + Intronic
1078152582 11:8772039-8772061 CTCTCTGAACTCAGAAGTTTTGG - Intronic
1078472851 11:11605453-11605475 CACCCTGAAGACACAGGTGGTGG + Intronic
1078868091 11:15317139-15317161 CTCTCTGAAGCCAGAATTTTGGG + Intergenic
1079701482 11:23554080-23554102 CTCCATGAAAATAGAAATGTAGG - Intergenic
1080282169 11:30569861-30569883 CTCCCTGTTGACTGAAGTCTAGG + Intronic
1080754277 11:35180539-35180561 CTCCATGGAGACAGGAATGTTGG - Intronic
1080793402 11:35541038-35541060 GTCCCTGAGGGCAGAAGAGTGGG + Intergenic
1081353047 11:42078955-42078977 CTCCCTCCAGAGAAAAGTGTAGG - Intergenic
1081622837 11:44629071-44629093 CTCCCTGAAGGCAGATCTGAGGG - Intergenic
1081765162 11:45605385-45605407 CTCCCTGGGGACAGAAGGGGAGG - Intergenic
1084695705 11:70754220-70754242 CTCCCAGAAAAGAGAAGTGGAGG + Intronic
1085153007 11:74267240-74267262 AGCCCTGAAGACTGAACTGTTGG - Exonic
1086051603 11:82598452-82598474 CTCTCAGTAGACTGAAGTGTGGG - Intergenic
1087269426 11:96096616-96096638 CTTCCTGAAGACACAGGTGTAGG - Intronic
1089627581 11:119761439-119761461 CTCCCAGCAGACAGAGGTGGTGG - Intergenic
1090957709 11:131528193-131528215 CTCCCTGATAACAGAACTTTGGG - Intronic
1091419436 12:323370-323392 CTCCCTGAATTAAGAAGTGTGGG - Intronic
1091908010 12:4205082-4205104 CTCCTTGAAGACAGAGCTGTTGG - Intergenic
1093147592 12:15585359-15585381 CTTCCTGAAGAGAGCAGTGAGGG + Intronic
1095961036 12:47834538-47834560 CTCCCTCAAGGCTGAAGAGTGGG + Intergenic
1098846593 12:75544597-75544619 ATCACTGAAGCCAGAAGTCTTGG - Intergenic
1099116215 12:78627851-78627873 CTCCCTGAAGAAAAAAGGGTAGG + Intergenic
1099303060 12:80921623-80921645 TTCCATGAAGTCAGAAGGGTGGG - Intronic
1101323277 12:103692415-103692437 GACCCTGGAGACAGAACTGTGGG - Intronic
1102617454 12:114166983-114167005 CTCCCTGAGGACAGAGATGTTGG - Intergenic
1104292209 12:127481170-127481192 CTCCCTGAAGAAAGAATTCCTGG - Intergenic
1105660228 13:22485933-22485955 CTCCCTGAAAACAGAAATAAAGG + Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1107042511 13:35964486-35964508 CTTCCTGAAGGCAGAATTTTAGG - Intronic
1108297792 13:49042034-49042056 CTCCCTGACGACCAAATTGTAGG - Intronic
1108698177 13:52921044-52921066 CTCCATCAAAACAGTAGTGTGGG - Intergenic
1108730379 13:53229457-53229479 CTTCCTGAACCCACAAGTGTGGG - Intergenic
1111941132 13:94608119-94608141 CTCCCTGTATACAGAAGTTCTGG - Intronic
1112264377 13:97909473-97909495 CTCCCTCGATACAGAAATGTTGG - Intergenic
1113816873 13:113178088-113178110 CTCCCTGAAGCCGGAACTCTTGG - Intronic
1114492701 14:23113365-23113387 CTCTCTGAAGTCAGAATTGATGG + Intergenic
1116178139 14:41499756-41499778 CTCCCTGAAGGCAGGAGAGGAGG - Intergenic
1117526738 14:56614718-56614740 CACACAGAACACAGAAGTGTGGG - Intronic
1118882449 14:69841135-69841157 CTCCCTGAAGCCAGAGGTACAGG - Intergenic
1119075555 14:71634537-71634559 CTCCCTGAACACAGAATTCTGGG - Intronic
1122936030 14:104956686-104956708 CTTCCTGCAGCCACAAGTGTTGG + Exonic
1126878060 15:53065389-53065411 ATCCTTGAAAACACAAGTGTAGG - Intergenic
1128569930 15:68726541-68726563 TTCCCTGAAGACAAGAGGGTGGG - Exonic
1129579602 15:76793435-76793457 CTCCCTGAAGGCTGAGGAGTTGG - Intronic
1132198613 15:99932498-99932520 CTGCCTGAAAGCAGAAGTGGTGG + Intergenic
1132207013 15:99993316-99993338 CTTTTTGAGGACAGAAGTGTGGG - Intronic
1135781350 16:25304161-25304183 CTCCCAGATGGCAGAAGTGCAGG + Intergenic
1137931520 16:52592401-52592423 CTCCATAAAGGCAGAATTGTTGG - Intergenic
1139489297 16:67278163-67278185 CTTCCTGAAGCCAGGAGGGTGGG + Exonic
1139578451 16:67857338-67857360 CTCCCTGCAGGCAGAAGAGGAGG + Intronic
1140523198 16:75599776-75599798 CTCCCTGAAGAAAGAAAGGCTGG + Intronic
1141741504 16:85896269-85896291 GCCCCTGAAGACAGAAAGGTAGG + Intergenic
1144046455 17:11458657-11458679 CTCCCAGAAGATAGAAAAGTGGG - Intronic
1146249558 17:31326685-31326707 CTCCATGATGACACAAATGTTGG - Intronic
1146500435 17:33359761-33359783 CTCCCAGAATACAGATGTGATGG + Intronic
1147196752 17:38771614-38771636 CTCCCTGAAGAAAGGAGTTGAGG + Intronic
1147421259 17:40323157-40323179 CTCCCCACAGACAGAAGTCTGGG - Intronic
1148440013 17:47707138-47707160 CTCCCTGAAGGCAGAGATTTAGG - Intronic
1148852952 17:50563537-50563559 CTCCCTGAAAACAGACCTCTAGG + Intronic
1148947761 17:51280135-51280157 CTCCCACAAGACACTAGTGTAGG + Intronic
1152504631 17:80740376-80740398 CTTCCAGAAGATAGAAGGGTTGG + Intronic
1152655304 17:81516665-81516687 CAGCCAGGAGACAGAAGTGTGGG - Intronic
1152818060 17:82420461-82420483 CTCCCTGAAGGCTGAAGAGGAGG - Intronic
1153598238 18:6751044-6751066 CTCCCTGAAAGCAGAAGTCAGGG + Intronic
1156031677 18:32720535-32720557 CTGCCTCAAGAAAGAAGTCTGGG + Intronic
1156600794 18:38603695-38603717 CTCCCTGAAGGCAGAGGCTTTGG - Intergenic
1156966969 18:43106096-43106118 CTCACTAAACCCAGAAGTGTGGG - Intronic
1156992210 18:43422906-43422928 CTCCCAGAAGACTGATTTGTAGG + Intergenic
1157444998 18:47737958-47737980 CTCCCTGCAGACACAGGGGTTGG + Intergenic
1159713917 18:71797845-71797867 CACCGTGAAGACTGCAGTGTGGG + Intergenic
1160942267 19:1625895-1625917 CTTCGTGAAAACAGCAGTGTGGG - Intronic
1163328018 19:16617829-16617851 CTCCCTTAAGGCAGAAGTGAAGG + Intronic
1163667371 19:18609719-18609741 TTCCCTGAAGTCAAAGGTGTGGG - Intronic
1166052028 19:40266083-40266105 GTCCCTGAGGACAGAAGTGAAGG - Intronic
1167163339 19:47781373-47781395 CGCCCTGAAGGCAGAGGTGAGGG + Exonic
926410140 2:12594559-12594581 CTCCCTGAAGACAGCAGATTTGG + Intergenic
926773384 2:16398031-16398053 CTGCCTGCAGAGTGAAGTGTGGG - Intergenic
927471253 2:23379350-23379372 CTCCCTGGAGATGGAAGTGTTGG - Intergenic
927756439 2:25712080-25712102 CTCCCTGAAGACAGAGTTCCTGG + Intergenic
928342376 2:30455950-30455972 CTTCCAGAAAACAGAAGCGTAGG - Intronic
928845183 2:35662952-35662974 CTCACTGAAGAAAAAAATGTAGG - Intergenic
929211622 2:39363919-39363941 TTCCCTGAAGACAGTAATGTTGG - Intronic
931151081 2:59574233-59574255 CTTCCTGAAGTGAGAAGTTTAGG - Intergenic
931178171 2:59874163-59874185 CTTCCAGAAGGCAGAACTGTGGG - Intergenic
931236127 2:60413850-60413872 CTCCCTGGAAACAGATGTCTTGG + Intergenic
938057075 2:128223923-128223945 CTTCCAGAAAACAGAAGAGTTGG - Intergenic
938630372 2:133160206-133160228 CTCCCTGAAGGCAGTAGGGAAGG + Intronic
943119858 2:183722348-183722370 CTCAGTAAAGACAGAAGTATTGG + Intergenic
944466052 2:200000713-200000735 GTCCCAGAAGACAGCAATGTAGG + Intronic
945024815 2:205610177-205610199 CTCCCTGAGAACAGACGTGATGG - Intronic
945293497 2:208147792-208147814 CACCCTAAAGACAGCAGTGAGGG - Intergenic
1171538717 20:25925231-25925253 CACACTGAAGCCAGAAGTCTTGG + Intergenic
1172106055 20:32517887-32517909 CTCCCAGGAGATAGAAGTGCAGG - Intronic
1176050024 20:63114177-63114199 CTCCCTGAAGACGGAGCTTTTGG - Intergenic
1176252137 20:64130414-64130436 CTGTGTGAAGACAGAAGTGGTGG + Intergenic
1176729493 21:10478509-10478531 TTCCCTAAAGAGTGAAGTGTTGG + Intergenic
1178410713 21:32361636-32361658 CTCTCTGAAGACTTGAGTGTTGG - Intronic
1180083219 21:45496193-45496215 CTCCCTGATGTCAGCAGGGTGGG + Intronic
1182466470 22:30519945-30519967 TTCCCTGAAGCCTGAACTGTTGG + Intergenic
1184641085 22:45870646-45870668 CTCTCTCAAGGCAGAAATGTGGG - Intergenic
949192764 3:1269717-1269739 CTCCCTGAAAACTTAAGTGCTGG + Intronic
950148924 3:10671194-10671216 TTCCCTGAAGAAAGCAGAGTTGG + Intronic
950429397 3:12942154-12942176 CTCCCTGAGGACAGCAGTTTTGG + Intronic
953873220 3:46645679-46645701 CACCCTGAAGAGAGTAGTGCAGG - Intergenic
956339369 3:68204493-68204515 CTCCCTCAGGACACAACTGTTGG - Intronic
959106522 3:102071120-102071142 GTCCCTGATGACAAAAATGTTGG - Intergenic
960292968 3:115908873-115908895 TTGACTGAAGACAGAAGTGCCGG - Intronic
961140737 3:124553781-124553803 CTCCCTGTAGACAGGACAGTTGG + Intronic
961433435 3:126899608-126899630 CACCCAGAAGACAGAAGTTTGGG + Intronic
963326018 3:143863914-143863936 TTCCAGGAGGACAGAAGTGTTGG + Intergenic
965799194 3:172474206-172474228 CTTCATGAAGACAGTAGTGCTGG - Intergenic
966081081 3:176001968-176001990 AACCCTGAAGATAGAAATGTAGG - Intergenic
969162056 4:5268964-5268986 CTCCCTCAAGTCAGTAATGTGGG - Intronic
969316547 4:6384848-6384870 CTCTTTGCAGACAGAAGTGCTGG + Intronic
972281199 4:37603564-37603586 CTCACTGAGGACAGTAGAGTTGG - Intronic
974104726 4:57456763-57456785 CTACCTGATGACTGAAGTGAGGG + Intergenic
976022718 4:80649193-80649215 CTACCTGAAGTCCAAAGTGTTGG + Intronic
978730990 4:112026107-112026129 CTCCCTGCTGACAGGAATGTGGG - Intergenic
979271648 4:118769343-118769365 CTCCCGAAAGCCAGAAGAGTTGG - Intronic
980897286 4:138872069-138872091 CTCCATGAAGACAGAATTGCTGG - Intergenic
982844830 4:160237576-160237598 CTCCGTGGAGACAAAATTGTTGG - Intergenic
983484873 4:168321593-168321615 CTCCTTGAAAACAGAAGAGATGG - Intergenic
984210120 4:176837180-176837202 CTCACTGAGGACAGCAGCGTAGG + Intergenic
984289629 4:177779520-177779542 CTCCCTAAAGGCAGCATTGTGGG + Intronic
984860485 4:184233283-184233305 CAGGCTGAAGACAGAACTGTCGG + Intergenic
985798735 5:1986457-1986479 CTCCCTGAAAAAAAAAATGTTGG + Intergenic
986284176 5:6347818-6347840 GTCCCTGAAGAACGAAGGGTGGG + Intergenic
987580935 5:19791292-19791314 CTCACGGAACACAGATGTGTGGG + Intronic
987946463 5:24615635-24615657 CTCTCTGAAGCCTGAAGTGTTGG + Intronic
991034695 5:62117036-62117058 CTCTCTGGTGACAGAATTGTGGG + Intergenic
991185784 5:63805185-63805207 CTTTCTGAAGAGAGAAATGTAGG - Intergenic
992490318 5:77236271-77236293 CTACCTGTAGACACAAATGTGGG + Intronic
992750567 5:79857097-79857119 CTCCATGAAGAAAGCAGTGAGGG + Intergenic
995895339 5:117004804-117004826 CTCCCTGAGCACAGAAATATTGG - Intergenic
997658423 5:135572408-135572430 CTTCCTGGAGACAGAAGAGGTGG + Intronic
997998595 5:138606307-138606329 CTCCCTGAGGACAGAGAGGTTGG - Intergenic
998555366 5:143118040-143118062 CCCAGTGAAGGCAGAAGTGTTGG - Intronic
998679671 5:144453061-144453083 CTTCCTGAGGACAGAGCTGTTGG + Intronic
998743667 5:145231948-145231970 CTCCCTGAATACAGCATTCTGGG - Intergenic
999300184 5:150486097-150486119 CTCCCTGGAGACTGAAGGTTGGG - Intronic
999683470 5:154081624-154081646 CTCCCTGAGGACAGAGGTTTGGG - Intronic
1000676648 5:164130052-164130074 CTCCCTGAGGACAGGAGCATTGG + Intergenic
1001226093 5:169945925-169945947 CTTCCTGGAGCCAGCAGTGTGGG - Intronic
1001400240 5:171442068-171442090 CTCCCTGGGGACAGAAGTTGTGG - Intronic
1001749425 5:174117659-174117681 CCCCATGAAGACAGAGGTTTGGG + Intronic
1004594593 6:17087044-17087066 CACCCTAAAGACAAAGGTGTGGG - Intergenic
1005340115 6:24835803-24835825 CTCACTGAAGACACAGGAGTTGG - Exonic
1005598482 6:27402578-27402600 CTTCTTGAAGACAGAAATCTTGG + Exonic
1005901151 6:30217422-30217444 CTACCAGAAAACAGAAATGTTGG - Intergenic
1007616829 6:43184780-43184802 CTCCCTGAAGACACCAGTGAGGG - Exonic
1010933620 6:81834243-81834265 CTCCTTGAAGAAAAATGTGTGGG - Intergenic
1012493427 6:99808531-99808553 CTCCTTGAGTACAGAATTGTTGG + Intergenic
1014237211 6:118971810-118971832 CTTCCTGGAGAGAGAAGGGTGGG - Intronic
1014895872 6:126898385-126898407 CTCCCTGATGCCAAAAGAGTTGG - Intergenic
1015371328 6:132456914-132456936 GCCACTGCAGACAGAAGTGTAGG + Exonic
1016049255 6:139513350-139513372 CTTCCAGAAGACAGAAGTTTGGG - Intergenic
1016974483 6:149793633-149793655 CTCCCTGAAGACAGAAGTGTTGG - Exonic
1017036745 6:150273972-150273994 CGCTCTGGAGAAAGAAGTGTTGG + Intergenic
1017072791 6:150591033-150591055 GTCCCTGAAGAGAGAACTGAGGG - Intergenic
1017927025 6:158919494-158919516 CTCACTGAAGACAGAAATTTGGG - Intergenic
1017944194 6:159080298-159080320 CTCTCTAGAGACAGAGGTGTGGG + Intergenic
1019537966 7:1538649-1538671 CTCCCTCAAGACAGCTGTGCCGG - Intronic
1019629533 7:2040853-2040875 CTTCCTGCAAACAGAGGTGTTGG + Intronic
1020804781 7:12775591-12775613 CTCTCTGATGACAGTTGTGTAGG - Intergenic
1021534006 7:21682089-21682111 CCCCTTGAAGAGAGAGGTGTTGG + Intronic
1023270293 7:38455369-38455391 CTCCCAGAATAAAGAATTGTAGG - Intronic
1023784306 7:43691162-43691184 CTCCCTGAGGCCAGGAGTTTGGG + Intronic
1024000372 7:45185461-45185483 CTCCCTGAGGACAGAGGTCCTGG + Intronic
1028517314 7:91692058-91692080 CTGCCTGAAGACCTGAGTGTTGG - Intronic
1028718909 7:94006624-94006646 TTCCCTGAAGACTGAAATGATGG + Intergenic
1029217281 7:98959650-98959672 CTCCCTGGAGAGAGCAGTGGAGG - Intronic
1031270336 7:119641289-119641311 CTCCCTGATGACAAAAAGGTTGG + Intergenic
1031850700 7:126859045-126859067 CTCCCTAAAGGCAGCAGGGTTGG + Intronic
1037507927 8:19551025-19551047 CTGCCAGAAGACAGATGTGAAGG - Intronic
1037688565 8:21164056-21164078 CTCCCTCAAGACAGGATTATGGG + Intergenic
1037747082 8:21654363-21654385 CTCTCAGAAAAGAGAAGTGTGGG - Intergenic
1038983518 8:32784396-32784418 TTCCCTGAAGACTGATGGGTAGG - Intergenic
1042670541 8:71258175-71258197 CTCCTTGAAGGCAGAAATTTTGG + Intronic
1042685045 8:71428967-71428989 CTCTCTGCAGACAGGAGTGAAGG - Intronic
1043453521 8:80392088-80392110 CTCCCTGATGATTGGAGTGTGGG + Intergenic
1044388250 8:91616661-91616683 TTCTCTGAAGAAAGAAGTATAGG + Intergenic
1044406116 8:91828216-91828238 CTCACCAAAGACAAAAGTGTTGG - Intergenic
1044794652 8:95884788-95884810 TTCCCTGAGGACAGTAGTGTCGG + Intergenic
1046141037 8:110092502-110092524 GTCCCTCAAGACAGAAGTCCAGG - Intergenic
1046792622 8:118338071-118338093 CTATCTAAAGACAGAAGTCTTGG + Intronic
1047067902 8:121307100-121307122 CTGCCTAAAGACAGAACTTTTGG - Intergenic
1048165104 8:132055306-132055328 CTCCCTGAAGACACAGCCGTGGG + Intronic
1048666376 8:136665957-136665979 CTCCTTGATGACAGATGTGGAGG + Intergenic
1048889447 8:138934644-138934666 CTCCCTGCAGAAATAAGTATAGG - Intergenic
1049848620 8:144818692-144818714 CTAATTGAAGACAGAAGTTTTGG + Intergenic
1050745323 9:8869539-8869561 CTCCCAGGAGTCAGAATTGTTGG + Intronic
1051166137 9:14264105-14264127 TTCCCTGAGGCCAGAAGTCTGGG - Intronic
1053025859 9:34727566-34727588 CTCACTGAAGACAGAACCGGAGG + Intronic
1053221062 9:36313627-36313649 CGCTTTCAAGACAGAAGTGTCGG + Intergenic
1053486182 9:38458285-38458307 CTCCCTGAAAACAAACGTGTGGG - Intergenic
1056686133 9:88761826-88761848 CTTCCAGAAGACAGAAGAGTAGG + Intergenic
1056713700 9:89011532-89011554 CTCCCAGAGGACAGATGTGCAGG + Intergenic
1056950832 9:91039691-91039713 GTCCCTGAAGACAGTGGTGGAGG - Intergenic
1057094838 9:92296470-92296492 CTCCTTGAAGTCTGAAGTTTTGG + Intergenic
1058902812 9:109456899-109456921 TTCCTTGAATACAGAAATGTGGG + Intronic
1060373088 9:123093052-123093074 CTCACTGAAGGGAGGAGTGTGGG + Intronic
1060754684 9:126204139-126204161 CTTCCTGAGGACACAGGTGTGGG - Intergenic
1062334469 9:136058988-136059010 CTCCCTGCAGACAGGAGGGCGGG - Intronic
1185492592 X:529200-529222 CTCGATGAAGACAGAAGCCTTGG - Intergenic
1186820471 X:13282785-13282807 CACACTTAAGAGAGAAGTGTGGG - Intergenic
1187625837 X:21112741-21112763 CTGCCTGAAGCAAGAAGTATTGG + Intergenic
1190424486 X:50320160-50320182 CTTCCAGAAAACAGAAGGGTTGG - Intronic
1192000044 X:67140200-67140222 TTCCCTGAAGACAGAAAAATCGG + Intergenic
1193537685 X:82733671-82733693 CTCTCTGAAGACAGAAATCAGGG - Intergenic
1198082969 X:133256347-133256369 CTTCCTGAGGACAGAGGTCTTGG + Intergenic
1199002778 X:142659611-142659633 CTCCTTGAAGACAGAAATTTTGG + Intergenic