ID: 1016974989

View in Genome Browser
Species Human (GRCh38)
Location 6:149798771-149798793
Sequence TGCACTGCAAAACTCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016974989 Original CRISPR TGCACTGCAAAACTCTGAAA AGG Intronic
902333584 1:15742684-15742706 TGCACTGCAAAGAGCTGGAAGGG - Intronic
902800068 1:18823891-18823913 TGCAATGCAAAAGTATTAAACGG - Intergenic
904300803 1:29552167-29552189 TGCACTGCACAACTCACACATGG + Intergenic
904610917 1:31725910-31725932 AGGCCTGCAAAACTCTGAAGAGG + Intergenic
904760705 1:32802421-32802443 TAAACTGAAAACCTCTGAAAAGG - Intronic
906932072 1:50179735-50179757 TGCACTCCAGAAATTTGAAAAGG - Intronic
907620866 1:55978173-55978195 TGCATTGCACAACTATAAAATGG - Intergenic
908911917 1:69081284-69081306 TACAGTGCAAAACTCTAATAAGG + Intergenic
909449680 1:75784673-75784695 TGCACTCTGAAAATCTGAAATGG - Intronic
910044065 1:82890543-82890565 TGCACTGCAAACACCTGAATTGG - Intergenic
910115541 1:83727887-83727909 TTTACAGCAAAATTCTGAAAGGG - Intergenic
911981469 1:104572832-104572854 TGCAGTGACATACTCTGAAATGG + Intergenic
914503545 1:148268329-148268351 TGCAAGGCAAAACAATGAAAGGG - Intergenic
915410651 1:155699174-155699196 TTCAGGGCAAAACTGTGAAAGGG + Intronic
916942322 1:169688750-169688772 TTCCCTGCGAGACTCTGAAAGGG - Intronic
917253312 1:173086884-173086906 TGAAATGGAAAATTCTGAAATGG - Intergenic
918053880 1:181001527-181001549 TGCTCTGGATAACTCTGGAACGG + Intronic
918413558 1:184285094-184285116 TGAATTGCAAAACCCTGCAAGGG + Intergenic
922695211 1:227728022-227728044 TGCACTTCAAACTTATGAAAAGG - Intergenic
923180834 1:231517839-231517861 TGCAATGAAAAACTCTTAATTGG - Intergenic
923629156 1:235638335-235638357 TGGAGTTCAAAAGTCTGAAATGG + Intronic
1064144684 10:12818230-12818252 TACACTGAAATACTGTGAAATGG - Intronic
1065424942 10:25591183-25591205 TGCATTGTGACACTCTGAAAAGG - Intronic
1066275480 10:33864337-33864359 TCCAGTGCAAAACTCTGGATTGG + Intergenic
1066989581 10:42500108-42500130 ATCACTGCAAAACACTGCAAAGG - Intergenic
1068275427 10:54789688-54789710 TGCACTTCAAAATTAAGAAAAGG - Intronic
1068313167 10:55305629-55305651 GGCACTGCAAAACTATTCAATGG + Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068708061 10:60099387-60099409 TGCACTGCAAAAGTCCAAGAGGG - Intronic
1069082338 10:64101803-64101825 TGTACTGCAGAACTCATAAACGG - Intergenic
1071863707 10:89702273-89702295 GGCACTGCAAAACCCTAGAAGGG - Intronic
1075271099 10:121051634-121051656 TGAACTGCAAAGCCCTGTAAGGG + Intergenic
1075543069 10:123331772-123331794 TACTCTGCAAAACTGTTAAAAGG - Intergenic
1076610352 10:131722384-131722406 TGGCCTGCAGAGCTCTGAAAAGG - Intergenic
1078025624 11:7692524-7692546 CTCACTGCAAAATTCTGAGAAGG + Intronic
1080268901 11:30429619-30429641 TCTACTGCAAAACTCTGGCAGGG + Intronic
1080420328 11:32104191-32104213 TGCATTGCAAAACTCCAAATCGG - Intronic
1080656216 11:34260485-34260507 TGCAGTGCAGGGCTCTGAAAAGG + Intronic
1082035865 11:47644855-47644877 TGCACTGCATAACTCAGAGTGGG + Intergenic
1087102204 11:94376574-94376596 TGCACAGCTAAACTGGGAAAAGG - Intergenic
1088143159 11:106643057-106643079 TCCACTGCTAAACTCTGCTATGG + Intergenic
1088469422 11:110177316-110177338 TGCACTGCACAACTTTGAGCAGG + Intronic
1088509742 11:110562158-110562180 TTGACTGTAAAACTCTGGAAAGG - Intergenic
1088726149 11:112636949-112636971 TGCACTGCACAGCAATGAAAAGG - Intergenic
1089061755 11:115631581-115631603 TAGACTCCTAAACTCTGAAAGGG + Intergenic
1094046220 12:26169870-26169892 TGCTCTGCAACCCTCAGAAAAGG - Intronic
1095436876 12:42198683-42198705 TGCTCTGTAAAATTCCGAAATGG + Intronic
1098172508 12:67760992-67761014 TTCACTGCTAAGCTCTGACAAGG - Intergenic
1099337647 12:81384154-81384176 TGAAAAGCAAAACTATGAAATGG - Exonic
1099533720 12:83819941-83819963 TTCACTGGAATACTTTGAAATGG + Intergenic
1101227596 12:102705369-102705391 TGCATTGCAAAACCCTGGAAAGG - Intergenic
1105439646 13:20404656-20404678 GGCCCTGGAAAACTCTGGAATGG + Exonic
1106729142 13:32520986-32521008 TGCTCCCCCAAACTCTGAAAAGG + Intronic
1106809446 13:33345721-33345743 TTCATTGCAAAAATATGAAAAGG - Intronic
1107374637 13:39788973-39788995 TACACTGTAAAAATCTCAAAAGG + Intronic
1108349337 13:49576556-49576578 TGCACTGGAAAATTCTAAGAAGG - Intronic
1110442756 13:75543450-75543472 TGAAGTTCAAAAGTCTGAAATGG - Intronic
1111140160 13:84106682-84106704 TGCACTTGAAAGCTCAGAAAGGG + Intergenic
1112505771 13:99974823-99974845 TCCGCTGCAAAACGCAGAAAGGG - Intergenic
1113706344 13:112435550-112435572 TCCACTGCTAAACTGTGCAAAGG - Intergenic
1115126155 14:29996752-29996774 TGCACTGCAAAACACTTATCAGG - Intronic
1116760632 14:49008780-49008802 TTCACTGTAAAAATCAGAAAAGG + Intergenic
1116840701 14:49818451-49818473 TGCAATGTAAAACTCATAAAAGG + Intronic
1118000966 14:61523171-61523193 TGCACAGCAAATCTCTCAAGTGG - Intronic
1119208208 14:72810321-72810343 TGCAGTGCATATCTCTGACAGGG - Intronic
1120169987 14:81238477-81238499 TGCCCTGCAGTACTCTGCAAGGG - Intergenic
1123705828 15:22950579-22950601 TGCACTCCAAAAATATTAAACGG + Intronic
1124799104 15:32812113-32812135 TGAACTGCAGAACACAGAAAAGG + Intronic
1124804914 15:32871875-32871897 GGAAGTGCAAAACTCTGGAATGG + Intronic
1125282858 15:38061426-38061448 TGTACTCCAAACCTCTGAATAGG - Intergenic
1126284715 15:46997252-46997274 TGCACTGAAATACTGCGAAAAGG - Intergenic
1127367660 15:58306562-58306584 TGCACTGAAGTACTGTGAAAAGG - Intronic
1127885954 15:63201170-63201192 TGGTCTGCAAAATTTTGAAACGG + Intronic
1133700271 16:8302188-8302210 TGCACTGCAGATCTGTGCAAGGG - Intergenic
1136998420 16:35207605-35207627 TGCACTGCGCATGTCTGAAAGGG + Intergenic
1137611864 16:49823598-49823620 TGCTCTGCAACATTCCGAAAGGG + Intronic
1138069124 16:53973209-53973231 GCCACTGTTAAACTCTGAAATGG - Intronic
1139829173 16:69782623-69782645 TCCACTGGAAACCTCTGAAATGG - Intronic
1141410175 16:83827819-83827841 TGCCCTCCAGAACTATGAAAGGG + Intergenic
1141939842 16:87267888-87267910 TTCACTGCAAACCTGTGAAGTGG - Intronic
1144380020 17:14685619-14685641 TTCACTGCAGGACTGTGAAATGG + Intergenic
1146991549 17:37278063-37278085 TGCACAGCAAAACTACGTAAAGG + Intronic
1148374417 17:47129491-47129513 TGCACTGAAAAAATCAGAGAAGG - Exonic
1148430615 17:47640316-47640338 TGCAATGGAAAACGATGAAAAGG + Intergenic
1149206151 17:54250960-54250982 TGCAATGTCAATCTCTGAAAAGG + Intergenic
1150724027 17:67636969-67636991 TGCCCAGGAAAACTCAGAAAGGG - Intronic
1151166002 17:72204321-72204343 TGCAATGCCAAACTCAGGAATGG + Intergenic
1152975798 18:217135-217157 TCCAATCCAAAACTCTTAAATGG - Intronic
1153470022 18:5433755-5433777 TGCACAGTAAAATTCTGAGATGG - Intronic
1155811182 18:30237305-30237327 TGCACTGTAGATCTCTAAAAAGG + Intergenic
1156129811 18:33957623-33957645 TGCACTGGAGAACTTTGCAATGG + Intronic
1156580787 18:38372379-38372401 TGTACTGCTAATCTGTGAAATGG + Intergenic
1156838754 18:41586541-41586563 TGCCCAGCAAATCACTGAAAAGG + Intergenic
1158131770 18:54160020-54160042 ACCTCTGCAAAAATCTGAAAAGG - Intronic
1159200587 18:65178884-65178906 TGGATTGCAAAACTGTCAAAAGG - Intergenic
1159915598 18:74184941-74184963 TGCATTGGAAAACTCTCCAAGGG + Intergenic
1161574995 19:5050125-5050147 CCCACTGGAATACTCTGAAATGG - Intronic
1161594714 19:5145177-5145199 TACACTCCAAAACGGTGAAAGGG - Intronic
1162277862 19:9672178-9672200 TGCAATGCAAAAATCTTGAATGG + Intronic
1165812142 19:38618048-38618070 TGCACTGCACGACTGTGCAACGG + Intronic
1168698433 19:58419829-58419851 GACACAGCAAGACTCTGAAAAGG - Intergenic
925596039 2:5556236-5556258 TGCACAGCACATCTCTCAAAGGG + Intergenic
926530416 2:14038255-14038277 TGCATTACAAAAATATGAAAGGG + Intergenic
930513819 2:52380613-52380635 TGCACTGCCAATCACTGAAGAGG - Intergenic
931874300 2:66495636-66495658 TGCCATGCAAAACTGGGAAAGGG - Intronic
933255120 2:80072025-80072047 AGCATTGCATGACTCTGAAAAGG - Intronic
935343400 2:102080118-102080140 AGAACTGCAAAACTCTTAGAAGG + Intronic
936363164 2:111825842-111825864 TACAGTGCAATACTCTGCAAAGG + Exonic
937197364 2:120171273-120171295 CACACTGCAGAACCCTGAAAAGG + Intronic
942244384 2:173993511-173993533 TGCTCTGCACAACTCTGAGTGGG + Intergenic
942388790 2:175470315-175470337 TCCAGTGGAAAATTCTGAAAAGG - Intergenic
942626032 2:177901648-177901670 TGGACAGCAAATCTCTGTAAGGG + Intronic
944583817 2:201156238-201156260 TGCATTGCAAATCTCTGAGGGGG - Intronic
944615701 2:201457721-201457743 TGAAATGAAAAATTCTGAAATGG + Intronic
946337483 2:219048230-219048252 AGCACAAGAAAACTCTGAAATGG - Intergenic
947118105 2:226792372-226792394 AGTACTGCGAAATTCTGAAAAGG + Intronic
948324486 2:237102530-237102552 TGCAGTCCACAAATCTGAAATGG + Intergenic
948760452 2:240187141-240187163 TTCCCTGCAAAACTCTGTGAGGG - Intergenic
1169760953 20:9093463-9093485 AACAATGCCAAACTCTGAAAAGG - Intronic
1170754666 20:19189395-19189417 AAAACTACAAAACTCTGAAAAGG - Intergenic
1170985263 20:21252120-21252142 TGCACAGAAAAAGTGTGAAAGGG - Intergenic
1172044061 20:32066858-32066880 AGCACTGCAAGACTCAAAAAGGG - Intronic
1172261461 20:33569678-33569700 TACACTGCTAAACTCTCAACAGG - Intronic
1172360007 20:34305503-34305525 TGCACTGCAGAATGCTGAAAGGG - Intronic
1176077801 20:63256385-63256407 TGCTCTGCTGAACTCTCAAAGGG - Intronic
1178425419 21:32475071-32475093 TTCACTGCAGACCTCTGTAAGGG + Intronic
1179481354 21:41680745-41680767 TGCTCTGCGTAGCTCTGAAAGGG + Intergenic
1182290083 22:29269795-29269817 TGCTCTGCAAAAGCCTGAAAAGG + Intronic
1184306479 22:43606365-43606387 AGCCCTGCAAACCTCTGCAAAGG + Intronic
1184484793 22:44770368-44770390 AGGAATGCAAAAGTCTGAAAAGG + Intronic
949494694 3:4620485-4620507 AGCACTGCAGAACCCTGGAAAGG - Intronic
951674800 3:25225891-25225913 TGCAACGCAAAAATCTGTAATGG - Intronic
953225101 3:41011334-41011356 TACAGTGGAAAACTCTGGAATGG - Intergenic
954946242 3:54427072-54427094 TGCAGTCCAAAACACAGAAAGGG - Intronic
957216926 3:77332068-77332090 TGTACTTAAAAACTCTGAAATGG + Intronic
959861900 3:111226004-111226026 AGCTCTGCAGAAGTCTGAAATGG + Intronic
963429372 3:145178843-145178865 TGCTTTGCAAAACACTGAAGTGG + Intergenic
963465593 3:145677519-145677541 TACACTGTAATATTCTGAAAGGG + Intergenic
964475325 3:157092598-157092620 TGCACTGCAAGCCTCTGATGTGG - Intergenic
965791891 3:172397633-172397655 TGAAATGCAAAACTAGGAAAAGG + Exonic
967147671 3:186619988-186620010 TGCACTGCATAAATGTGAAGGGG - Intronic
967701462 3:192597451-192597473 TGCACTGCAAAACAGTCAAATGG - Intronic
970225829 4:13855796-13855818 TGCACTTCAAAACTCCAAAATGG - Intergenic
970940497 4:21627214-21627236 TGCAGTGTAGAAATCTGAAAAGG - Intronic
971678761 4:29669734-29669756 TGCACTGGAAAACTATTAAGTGG - Intergenic
971980850 4:33747892-33747914 TGCACTGAAGACCTTTGAAAGGG + Intergenic
973797284 4:54440648-54440670 TGCCCTGAATAAGTCTGAAAAGG - Intergenic
974873269 4:67670581-67670603 TGCACTGATAAACTGTAAAATGG + Exonic
975183376 4:71372754-71372776 TGCAAAGCAAAACACTGAACTGG - Intronic
976730225 4:88254030-88254052 TCCACTGCAAAAGTCAGATAAGG - Intergenic
978167744 4:105629225-105629247 TGCTCAGCAAAGCTCTGAATTGG + Intronic
978592049 4:110334796-110334818 TACCCAGGAAAACTCTGAAAAGG + Intergenic
979149038 4:117284840-117284862 TGTACTGGAAAAATGTGAAAGGG + Intergenic
979182581 4:117750350-117750372 TGCAATGAAAGACTCTCAAAGGG - Intergenic
979846371 4:125517896-125517918 TTAACTGCAAAACATTGAAAAGG - Intergenic
980175960 4:129344978-129345000 TGCATTGCCCAGCTCTGAAATGG + Intergenic
982631813 4:157839573-157839595 TGAAATGCAAACATCTGAAATGG - Intergenic
983615395 4:169698745-169698767 TGCAAATCAAAAGTCTGAAACGG + Intronic
984421185 4:179524202-179524224 TTCACTGAAAAACTTTGAATGGG + Intergenic
984655512 4:182313541-182313563 TGCATGGAAAAAGTCTGAAAAGG + Intronic
984781296 4:183528356-183528378 TGCAGAACAACACTCTGAAAAGG - Intergenic
988710059 5:33764080-33764102 AGCACTGTAAGACTCTGCAAGGG + Intronic
988824170 5:34917722-34917744 TTAACTGCAAAACTCCTAAATGG - Intronic
993150579 5:84156370-84156392 TGATCTGGAAAAGTCTGAAATGG - Intronic
994832205 5:104799330-104799352 TGGACTGCAAAATCCTGAGATGG + Intergenic
995620152 5:114017181-114017203 AGAAATGCAAAAGTCTGAAAAGG - Intergenic
995731695 5:115250459-115250481 TGAATTGCAAACCTCTGGAAGGG - Intronic
998991011 5:147816988-147817010 TGAACAGTAAAACCCTGAAAAGG - Intergenic
1000565536 5:162842247-162842269 TGCAGTGAAATACTCTGAACTGG + Intergenic
1001010279 5:168091427-168091449 TGCAATACAAAGCTCTAAAAGGG + Intronic
1004036290 6:11927452-11927474 TGCAATGTAAAAATCTGGAATGG + Intergenic
1005728076 6:28669250-28669272 TGGAGTTCAAAAGTCTGAAATGG - Intergenic
1007048491 6:38801620-38801642 TGCAGTGCTAAACACTGGAATGG - Intronic
1008588158 6:52967653-52967675 TACACTGCAAAATTCTGAGGAGG + Intergenic
1009667457 6:66702950-66702972 TTCACTTCAACACTCTGTAAAGG + Intergenic
1010857370 6:80857320-80857342 TTCACTGCAAAATAGTGAAAAGG + Intergenic
1013407081 6:109852894-109852916 GGCACTGCAAGCCTATGAAAGGG + Intergenic
1014783908 6:125596378-125596400 TGCAATGTAATACTATGAAAAGG - Intergenic
1015575100 6:134662899-134662921 TGCAATGTAAAACTTAGAAAAGG + Intergenic
1015717679 6:136208897-136208919 TGAATTGGAAAACTCAGAAAGGG - Intergenic
1016092593 6:139998024-139998046 TGGATTCCCAAACTCTGAAATGG + Intergenic
1016974989 6:149798771-149798793 TGCACTGCAAAACTCTGAAAAGG + Intronic
1021504432 7:21365782-21365804 TGCACAGCATAACTAGGAAAAGG + Intergenic
1021655140 7:22867276-22867298 TGAACTGCATAACTCTTAAATGG + Intergenic
1024583603 7:50821842-50821864 TGCACTGCTAAAATATAAAAGGG + Intergenic
1025888948 7:65627622-65627644 TACACTGAAGAACTCAGAAATGG + Intergenic
1027929464 7:84512813-84512835 TAAACTCCAAAAGTCTGAAATGG - Intergenic
1028015906 7:85711801-85711823 TAAACAGCAAAACTCTGTAATGG - Intergenic
1030013800 7:105198224-105198246 TGCACTGTAAACCCCTGAATTGG - Intronic
1030145261 7:106346701-106346723 TGCACTACAAGAAACTGAAAAGG + Intergenic
1030734862 7:113035827-113035849 TGCATTGCAAGATTCTGAAAAGG - Intergenic
1032999715 7:137491132-137491154 TCTACTGCAAAACCCTCAAAAGG + Intronic
1033396667 7:140980676-140980698 TGCACAGCAAAACTATCAACAGG - Intergenic
1034900076 7:154902704-154902726 TTGACTGCAAAACACAGAAAAGG - Intergenic
1035816324 8:2545044-2545066 TGCAAAGCAAAACTCTGGACGGG + Intergenic
1039311228 8:36320736-36320758 TGCCCTGTGAAAGTCTGAAACGG - Intergenic
1039480643 8:37870847-37870869 TTCACTGTAAAACTCTGCAGAGG + Intronic
1040897693 8:52385851-52385873 TCCACTGCAACACCCTGACAGGG - Intronic
1042435264 8:68757099-68757121 TGCACAGCAAGACTTTAAAACGG - Intronic
1042594074 8:70426776-70426798 GACACTACAAAACTCTGAATTGG + Intergenic
1046155992 8:110290715-110290737 TGAACTGGAAATCTCTGAAGAGG - Intergenic
1047775547 8:128067506-128067528 TGCAGTGGGAAACTCAGAAAAGG + Intergenic
1049123764 8:140766665-140766687 TGCACTGCAACAATCAGTAAAGG + Intronic
1049500923 8:142965175-142965197 GGCAATGTAAAACTCTGAATTGG + Intergenic
1050651548 9:7782281-7782303 TGCACTGCATACTTTTGAAAAGG + Intergenic
1050740378 9:8813040-8813062 TACACTGCATAGCTATGAAATGG + Intronic
1050761550 9:9078374-9078396 TTTACTGCAAAATTCTGGAAAGG - Intronic
1051131259 9:13863467-13863489 TACACTTCAACACTCTTAAAGGG + Intergenic
1051275335 9:15393022-15393044 TGTTCTGGAAAATTCTGAAATGG + Intergenic
1052390332 9:27871892-27871914 TGCCTTGCCAAACTCTGGAAAGG + Intergenic
1056435559 9:86572467-86572489 TGCACTGAAAAACACTTAAAAGG - Intergenic
1056453309 9:86737487-86737509 TGCCCTGCAAGCTTCTGAAAGGG + Intergenic
1056888927 9:90471275-90471297 AGCACGGCAGGACTCTGAAAGGG + Intergenic
1057029803 9:91766960-91766982 TGCACTGCAAATCTCTGGACAGG + Intronic
1059133992 9:111785850-111785872 TGCTGTGCTAAACTCTGAAATGG + Intronic
1059788829 9:117617582-117617604 TGCACTGCTAAACTCTGCTTGGG + Intergenic
1186904090 X:14092725-14092747 TACATTTCAAAACTCTAAAATGG - Intergenic
1187136344 X:16551267-16551289 GAAACTGCAAAACTGTGAAAGGG - Intergenic
1187725960 X:22202425-22202447 TGCATTTCAAAACCCTCAAATGG - Intronic
1188408988 X:29848482-29848504 TGCTCTGCACAAGTCTGAAAAGG - Intronic
1188440073 X:30207991-30208013 TGCACTGGAAAACTCCAAAAGGG - Intergenic
1196274416 X:113750363-113750385 TGTACTGTAAAACTCTAAAAAGG - Intergenic
1197211555 X:123832158-123832180 TGCAGTGGAAAAATCTGAGAGGG - Intergenic
1197450541 X:126609357-126609379 TGTAAAGCAAAACTCAGAAATGG + Intergenic
1197663115 X:129194900-129194922 CGAAATGCAAAAGTCTGAAAAGG + Intergenic
1197856010 X:130914892-130914914 TGCACTGCATAATTCTGGGACGG - Intergenic
1199896269 X:152130576-152130598 TGCAATGCAAAAAGCTGAAGGGG - Intergenic
1201214722 Y:11712419-11712441 TGGAATGCAAAAGTATGAAATGG + Intergenic