ID: 1016975795

View in Genome Browser
Species Human (GRCh38)
Location 6:149806341-149806363
Sequence ATGTAGAGACTAGCCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016975792_1016975795 29 Left 1016975792 6:149806289-149806311 CCAGGCATTGAAGTGGTCAGAAT 0: 1
1: 0
2: 2
3: 6
4: 126
Right 1016975795 6:149806341-149806363 ATGTAGAGACTAGCCTGGGAAGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016975795 Original CRISPR ATGTAGAGACTAGCCTGGGA AGG Intronic
904713492 1:32449174-32449196 CTGTAGGGTCCAGCCTGGGAGGG - Intergenic
905107393 1:35572674-35572696 AGAGAGAGACTTGCCTGGGATGG - Intergenic
905778342 1:40685789-40685811 ATGTATTGGCTAGGCTGGGAGGG - Intergenic
906058749 1:42935033-42935055 GTGAAGAGACTGGGCTGGGAAGG - Intronic
910057501 1:83050190-83050212 ATCACGAGACTAGCATGGGAAGG + Intergenic
912317469 1:108679373-108679395 ATCTAGAGATAAGGCTGGGATGG + Intergenic
913055777 1:115158317-115158339 GTGAAGAGACTTGCCTGGCATGG + Intergenic
914976904 1:152374186-152374208 ATGTTGAGAATAGACTGAGAAGG + Intergenic
917631009 1:176891501-176891523 ATGTAGATACAAGCCGGGCACGG + Intronic
917749909 1:178043809-178043831 ATGTAGAGGCTAGCCTAAAAAGG - Intergenic
920013102 1:202884592-202884614 ATGTGGAGACCAGGCTGGGGGGG + Intronic
920292779 1:204935729-204935751 ATGCAAAGGCTAGCGTGGGAAGG + Intronic
920746324 1:208632444-208632466 ATGCAGAAATTAGCCGGGGATGG - Intergenic
920971233 1:210745268-210745290 ATGTAGGGACTAACCTGGATTGG + Intronic
921371542 1:214428107-214428129 TTGTAGACACTGGACTGGGAGGG + Intronic
922497588 1:226070956-226070978 AGGAGGAGACTAGGCTGGGATGG + Intronic
922946158 1:229515904-229515926 ACATACAGACAAGCCTGGGACGG + Intergenic
923100180 1:230807978-230808000 ATGTAGAGGGTAGACTGGGAAGG - Intergenic
923100297 1:230809060-230809082 ATGTAGAAGGTAGACTGGGAAGG - Intergenic
924089934 1:240491873-240491895 ATGTAGAAATTGGCTTGGGATGG - Exonic
1063068034 10:2629389-2629411 ATGTAGAGACTCACGTGGGTGGG - Intergenic
1063137343 10:3229209-3229231 AAATAGAGGCTAGACTGGGAAGG - Intergenic
1064595968 10:16945610-16945632 ATATAAAAACTAGCCTGGGATGG + Intronic
1065811730 10:29449273-29449295 ATGCAGGGACTGGCCAGGGAAGG - Intergenic
1065960058 10:30726872-30726894 ATGCAGGGACTGGCCAGGGAAGG + Intergenic
1067295708 10:44974200-44974222 GAGGAGAGACTGGCCTGGGATGG - Intronic
1070836390 10:79449574-79449596 GTTTAGAGAGCAGCCTGGGAAGG - Intergenic
1070948949 10:80415462-80415484 ATGGACAGGCTAGGCTGGGATGG - Intronic
1072397206 10:95056847-95056869 ATGTGGAGCTTAGCCTGGGAGGG + Intronic
1073149412 10:101301793-101301815 ATGAAGAGAGGAGCTTGGGAGGG - Intergenic
1075873758 10:125789748-125789770 GTGCAGAGCCTCGCCTGGGATGG + Intronic
1076948462 10:133666648-133666670 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076949451 10:133669958-133669980 AGGGAGAAACCAGCCTGGGAGGG - Intronic
1076950435 10:133673257-133673279 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076951420 10:133676556-133676578 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076952410 10:133679866-133679888 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076953398 10:133683176-133683198 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076955366 10:133742827-133742849 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076956356 10:133746137-133746159 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076957344 10:133749446-133749468 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076958333 10:133752756-133752778 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076959317 10:133756055-133756077 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1076960306 10:133759365-133759387 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
1077797977 11:5510886-5510908 ATGATGAGACTAGCTTTGGAAGG + Intronic
1079114719 11:17633996-17634018 AGGGAGAGTCTAGCCTGGGAAGG + Intronic
1079238320 11:18705276-18705298 ATGAAGACAGTAGACTGGGAAGG + Intronic
1079427618 11:20358525-20358547 AGGTAGGGACCAGCCTGTGAAGG - Intergenic
1085097395 11:73772584-73772606 AAGTAGAGTGTAGCCTGAGAAGG + Intergenic
1085281734 11:75335427-75335449 ATTTAAAAATTAGCCTGGGATGG + Intronic
1088484717 11:110329444-110329466 ATGTATAGAAAAGCCTGGGCTGG - Intergenic
1091505587 12:1064547-1064569 ATGTAAAAAGTAGCCAGGGATGG - Intronic
1094749592 12:33390482-33390504 ATGTAGAGACTAGATTAGTAGGG - Intronic
1102051072 12:109862292-109862314 GTGTAGAGGCCAGCCTGGGGAGG + Intronic
1102194865 12:111017935-111017957 AGTTAGAGACCAGCCTGGGCAGG + Intergenic
1102438122 12:112941208-112941230 ATGTAAAAACTAGCCAGGCATGG + Intronic
1103416233 12:120743090-120743112 AGTTTGAGACTAGCCTGGGCTGG - Intergenic
1107126951 13:36856430-36856452 ATGCAGAGAAGAGCCTGGGCAGG + Intronic
1110200031 13:72839104-72839126 ATGTAGAGAATAGATTGGAATGG + Intronic
1111437384 13:88227957-88227979 ATGAAGTCACTAGCATGGGAGGG + Intergenic
1111609895 13:90590697-90590719 ATGCAAAAATTAGCCTGGGATGG + Intergenic
1113475321 13:110576427-110576449 ATGTAAAAACTAGCCAGGCATGG + Intergenic
1113477636 13:110596089-110596111 ATGTAAAAATTAGCCTGGCATGG - Intergenic
1115334519 14:32231541-32231563 ATGCAGAGCCTGGCATGGGAAGG + Intergenic
1117470826 14:56042871-56042893 ATGCACTGACCAGCCTGGGAGGG + Intergenic
1117936841 14:60916497-60916519 ATGTAAAAATTAGCCAGGGATGG + Intronic
1118159910 14:63277765-63277787 CTGTAGATTATAGCCTGGGAAGG + Intronic
1119617393 14:76107806-76107828 ATGAAGAGAGTGACCTGGGAAGG + Intergenic
1120947874 14:90015072-90015094 TTGTAGACTCTAGCCTGGAAAGG + Intronic
1121367303 14:93325457-93325479 ATATAGAGAATAGCCAGAGATGG + Intronic
1121515009 14:94543708-94543730 ATGGTGAGGCTAGCCTGGCATGG + Intergenic
1121964844 14:98294711-98294733 ATGGAGAGAGTCACCTGGGAAGG - Intergenic
1202854484 14_GL000225v1_random:42354-42376 AGGGAGAAACTGGCCTGGGAAGG - Intergenic
1123811640 15:23932561-23932583 ATGGAGGGACTAGACAGGGAAGG + Intergenic
1124899246 15:33807262-33807284 ATCTAAAGACCAGCCTGGGTCGG + Intronic
1125218834 15:37309578-37309600 AATTAAAAACTAGCCTGGGATGG + Intergenic
1127657995 15:61073695-61073717 ATGTAGGAAGTAGCTTGGGAAGG - Intronic
1128162888 15:65435979-65436001 AAGTACAGACTAGCATGGGATGG - Intergenic
1130373317 15:83305833-83305855 ATGAAGTCACTCGCCTGGGAGGG - Intergenic
1132711135 16:1268338-1268360 ATATAAAAATTAGCCTGGGATGG + Intergenic
1133240097 16:4409073-4409095 AGGTAGAGACTAGGCATGGAGGG + Intronic
1134282896 16:12833481-12833503 ATGTTGAGACCAGCCTAGGCTGG + Intergenic
1135757997 16:25113925-25113947 ATGAAAAGACTAGGCTGGGTGGG - Intronic
1137704683 16:50526477-50526499 AGGAAGAGACTTGCCTGGGGAGG + Intergenic
1138991819 16:62399198-62399220 ATGTAAAGAGTAGCCAGGCATGG - Intergenic
1141537025 16:84689030-84689052 GTGTGAAGAGTAGCCTGGGAGGG - Intergenic
1142691467 17:1608547-1608569 ATGCAAAAATTAGCCTGGGATGG - Intronic
1143631271 17:8141785-8141807 ATGGTGAGAGAAGCCTGGGACGG - Exonic
1144959975 17:19039472-19039494 AGGCAGAGACAAGCCTGGCAGGG - Intronic
1144975185 17:19135052-19135074 AGGCAGAGACAAGCCTGGCAGGG + Intronic
1147310814 17:39595322-39595344 ATGTGGAGACTGGCCTAGGAGGG + Intergenic
1147698351 17:42374309-42374331 ATATAGAACCTAGCCTGGGCTGG + Intronic
1148096261 17:45054401-45054423 ATGTAAAAATTAGCCTGGCATGG - Intronic
1149431733 17:56599517-56599539 ATTTAAAAACTAGCCAGGGATGG + Intergenic
1153455616 18:5279012-5279034 GTTGAGAAACTAGCCTGGGAAGG - Intergenic
1156335290 18:36166035-36166057 ATGTAAAGATTAGCCAGGCATGG + Intronic
1157464819 18:47933992-47934014 CTACAGAGACTGGCCTGGGATGG - Intergenic
1160386251 18:78498731-78498753 ATGTAGAGACTTGTCTGGCCAGG - Intergenic
1161033996 19:2073873-2073895 ATATAGAAATTAGCCTGGCATGG + Intronic
1161945787 19:7435631-7435653 CTCTAGAAACTGGCCTGGGAGGG + Intronic
1163460529 19:17434883-17434905 ATGTAAAAACTAGCCGGGCATGG + Intergenic
1165406058 19:35631967-35631989 ATGTAGAAAATGGCCTGGGGGGG - Intronic
1167111421 19:47464265-47464287 ATATAAAAACTAGCCTGGCATGG - Intronic
1167931657 19:52870855-52870877 ATGCAGAGTCTAGCCTGGCATGG + Intronic
926858816 2:17286015-17286037 ATGTAAGGCCTTGCCTGGGAAGG - Intergenic
929433013 2:41904503-41904525 TTATAGAGACTAGGGTGGGAGGG + Intergenic
930741413 2:54836261-54836283 ATGTAAAAGCTAGCCTGGGTGGG + Intronic
931248862 2:60513126-60513148 ATGGATAGTCTAGCCTGTGAGGG + Intronic
933704610 2:85280442-85280464 ATGTAAACCCTAGTCTGGGATGG - Intronic
934147362 2:89108629-89108651 ATATAAAAACTAGCCTGGCATGG - Intergenic
934221909 2:90091963-90091985 ATATAAAAACTAGCCTGGCATGG + Intergenic
935158022 2:100501133-100501155 ATGTAGAGAGGATCCTGGCAGGG + Intergenic
937515380 2:122649255-122649277 ATGTAGCTACTAGTCAGGGAAGG - Intergenic
938914289 2:135919319-135919341 ATGTAGAAATTGGCCTGGCAAGG - Intronic
942963521 2:181861597-181861619 AGGTAGAGACAAGGCTGGGAGGG - Intergenic
943980842 2:194548399-194548421 ATGTAGAAATTAGCCTGGCGTGG - Intergenic
944317838 2:198302345-198302367 ATGTACAAGGTAGCCTGGGATGG - Intronic
944562652 2:200956383-200956405 AGTTTGAGACTAGCCTGGCATGG - Intronic
948979263 2:241484712-241484734 ATGTAGGCACATGCCTGGGATGG + Intronic
1168949937 20:1790585-1790607 ACGTGCAGACTAGCATGGGAGGG + Intergenic
1169256920 20:4106639-4106661 ATGTAAAAATTAGCCAGGGATGG + Intergenic
1171141835 20:22750091-22750113 AAGTAGAGACTAGCCATGGTGGG - Intergenic
1172873817 20:38152230-38152252 ATGGAGAAGCTGGCCTGGGAAGG + Intronic
1173669836 20:44791060-44791082 CTGTGGAGACTGGCCTGTGAAGG + Intronic
1175154023 20:56957466-56957488 ATGAGGAGACTGGACTGGGAGGG + Intergenic
1177273835 21:18881062-18881084 AGGTAGAGATTGGCCTGAGAAGG + Intergenic
1177918492 21:27122426-27122448 ATGTGCATACTAGCCTGTGAAGG - Intergenic
1178052315 21:28761650-28761672 CTGTATAAACTGGCCTGGGAAGG + Intergenic
1178983042 21:37281345-37281367 AGTTAAAGACTAGCCTGGGCAGG - Intergenic
1180661978 22:17475581-17475603 ATGTAGAAACTAGCCGGGTGTGG - Intronic
1184617656 22:45648839-45648861 GTGTGGAGGCTAGCATGGGATGG - Intergenic
1184714627 22:46273826-46273848 ATGTGGAGTCTGGGCTGGGATGG + Intronic
1185129058 22:49027338-49027360 ATGCAGAGACCAGGCTGTGAGGG - Intergenic
949284731 3:2388687-2388709 ATATAGAAATTAGCCTGGGATGG + Intronic
951102859 3:18709576-18709598 AGGCAGAAACTGGCCTGGGAAGG + Intergenic
952406876 3:33013074-33013096 AGGTAGAGACTAGATTGGGACGG - Intronic
953293406 3:41688939-41688961 CTGTAGCCATTAGCCTGGGATGG + Intronic
953985089 3:47435674-47435696 ATGTATAAACTAGCCAGGCACGG - Intronic
954853833 3:53625964-53625986 ATTTACAGACTAGGCTGGGGTGG + Intronic
955791026 3:62588933-62588955 ATGCAGAGACTATCTGGGGAAGG + Intronic
955898786 3:63729386-63729408 ATGTATACCATAGCCTGGGAAGG + Intergenic
956607403 3:71086577-71086599 ATGGAGTCTCTAGCCTGGGATGG - Intronic
960111939 3:113853775-113853797 GTGTAGAGAATAGCATGGGAGGG + Intronic
960153375 3:114273645-114273667 ATCTAGAGAATAGCCTCAGAAGG - Intergenic
962417109 3:135193198-135193220 ATGCAGAGAGCAGTCTGGGAGGG - Intronic
964087741 3:152836885-152836907 ATGGAGATACAAGCCTGTGAAGG + Exonic
964343337 3:155731146-155731168 CTGCAGAGGCTGGCCTGGGATGG - Intronic
965447360 3:168791661-168791683 AGGTAGAGGGTAGACTGGGAAGG + Intergenic
967481633 3:189979810-189979832 ATGAAGAAATTAGCCTGGCATGG + Intronic
967622769 3:191652886-191652908 ATATGGAGACTTGCCTGGGATGG - Intergenic
967622786 3:191653183-191653205 ATATGGAGACTTGCCTGGGAGGG - Intergenic
969148054 4:5141590-5141612 ATGTGGAGAATAGCCTGGGAGGG + Intronic
969995992 4:11313881-11313903 ATGTACATACTTGCATGGGAAGG + Intergenic
970379149 4:15489250-15489272 CTGGAGAGACTGGCCTGGGGTGG + Intronic
970717105 4:18939156-18939178 ATGTGGTTACAAGCCTGGGAGGG + Intergenic
972235698 4:37131365-37131387 AGGTAGAGACGAGGCTGGAAGGG + Intergenic
972337098 4:38116831-38116853 CTCTAGAGAGTATCCTGGGAGGG + Intronic
972913767 4:43850506-43850528 ATGTAAAAACTAGCCGGGCATGG + Intergenic
976442556 4:85092217-85092239 ATGTAGAAATTAGCTTGGTATGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980512240 4:133809547-133809569 AAGAAGAGAGTAGACTGGGATGG - Intergenic
981662343 4:147182922-147182944 ATGTTGAGAGTAGACTGGAAGGG - Intergenic
985082937 4:186284790-186284812 ATTTAAAAACTAGCCTGGCATGG + Intronic
985451916 4:190067453-190067475 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985452905 4:190070744-190070766 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985453892 4:190074037-190074059 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985454880 4:190077330-190077352 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985455868 4:190080627-190080649 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985456851 4:190083921-190083943 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985457839 4:190087217-190087239 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985458827 4:190090514-190090536 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
985463079 4:190173277-190173299 AGGGAGAAACCAGCCTGGGAGGG - Intergenic
988191161 5:27936874-27936896 GGCTAGAGACTATCCTGGGAGGG + Intergenic
988689244 5:33555926-33555948 ATGGAGAAACTGGCCTGAGAAGG - Intronic
988817554 5:34849881-34849903 ATGTAGAAAGTAGACTGTGAGGG + Intronic
992650814 5:78857989-78858011 AGGTAGAGACAAGCTTGGCATGG + Intronic
992852583 5:80825259-80825281 ATGTAGAGAAATGCATGGGATGG - Intronic
994165932 5:96608126-96608148 ATGTAGAGACTAGACTAGACTGG - Intronic
995386882 5:111598215-111598237 AAGTAGAGAAGAGCTTGGGAGGG - Intergenic
997628119 5:135345170-135345192 ATCCTGAGACTAGCCTGGAAGGG + Intronic
998233344 5:140375988-140376010 ATGTAAAAATTAGCCTGGCATGG + Intergenic
1000491775 5:161922914-161922936 AAGTAGTGAGTATCCTGGGATGG + Intergenic
1000947518 5:167439461-167439483 AGGAAGACACTAGCCTAGGAAGG - Intronic
1001003837 5:168031987-168032009 ATGTAGAGTCTGGCTTTGGAGGG + Intronic
1001735707 5:173997688-173997710 AGGTAGAAATTTGCCTGGGAGGG + Intronic
1002901709 6:1415365-1415387 ATGAAGTGATTAGCCAGGGAGGG - Intergenic
1003952091 6:11125969-11125991 ATCTAGAGAATAGCCTCAGAAGG - Intronic
1007004935 6:38352219-38352241 ATTTAGAAACTAGCCAGGCATGG + Intronic
1008721368 6:54357801-54357823 ATGTTGAGACTAGACTGTCAAGG - Intronic
1011285646 6:85719486-85719508 AGTTTGAGACTAGCCTGGGCTGG + Intergenic
1013420695 6:109964060-109964082 AATTGGAGCCTAGCCTGGGAGGG - Intergenic
1015560924 6:134515036-134515058 ATGCACAGACTAGCCAGGCATGG + Intergenic
1015878250 6:137845698-137845720 ATGTAAAGAGTAACCTGGGTGGG + Intergenic
1015964679 6:138686363-138686385 ATGTAAAAATTAGCCTGGCATGG + Intronic
1016975795 6:149806341-149806363 ATGTAGAGACTAGCCTGGGAAGG + Intronic
1018568888 6:165186404-165186426 CTGGAGAGACAAGCCTGGGTGGG - Intergenic
1018613316 6:165662958-165662980 ATGTGAAGACTAGACTGGGAGGG - Intronic
1019860278 7:3652368-3652390 ATGCACAGACAAGCCTGGGAAGG + Intronic
1020061582 7:5156449-5156471 ATGTAAAGATTAGCCAGGCATGG + Intergenic
1020166576 7:5812212-5812234 ATGTAAAGATTAGCCAGGCATGG - Intergenic
1021902788 7:25303891-25303913 ATTCAGAGAATAGCCTGGGTGGG - Intergenic
1024537694 7:50451418-50451440 ATGAAGTGACAAGCCTGGGGAGG - Intronic
1026253965 7:68694768-68694790 GTGTGGAGAATAGCCTGGGGGGG - Intergenic
1026409624 7:70106562-70106584 ATGTAGAAATTAGCCGGGCATGG + Intronic
1028463151 7:91118934-91118956 ACGTAGTGACCAGCCTGGGATGG + Intronic
1029003837 7:97185938-97185960 ATGTAAACACTAGCCAGGCATGG - Intergenic
1029305823 7:99619505-99619527 ATGTAGAGACAGAACTGGGATGG + Intronic
1034642985 7:152619790-152619812 ATGTAAAAATTAGCCTGGCATGG + Intergenic
1036947267 8:13106022-13106044 CTGTGGAGCCCAGCCTGGGAGGG - Intronic
1038513047 8:28158625-28158647 ATGAAGAGACTAACCTGGTATGG - Exonic
1041296054 8:56358671-56358693 TTGGAAAGACAAGCCTGGGATGG + Intergenic
1041451688 8:58012964-58012986 AGGGAGACACCAGCCTGGGATGG - Intronic
1045257115 8:100535550-100535572 AAGGAGAGACTGGCATGGGAGGG - Intronic
1046142258 8:110108956-110108978 AAGTAGAGAGTAGCATGGGTTGG - Intergenic
1049692221 8:143966477-143966499 AGGTAGAGAGCAGCCTGGGGTGG - Intronic
1051096159 9:13467743-13467765 ATGAAGAGATTAGACTGTGAGGG + Intergenic
1051399495 9:16664271-16664293 ATGTAGATGCCAGCCAGGGAAGG - Intronic
1052228663 9:26120530-26120552 ATGTACAGAATAGCCTGGAAGGG + Intergenic
1053184728 9:36005893-36005915 ATGAAGAGACAAGCAAGGGATGG + Intergenic
1186695996 X:12032656-12032678 ATGGAGAGACTAGCCTTAGAAGG + Intergenic
1189092985 X:38107167-38107189 TTCTAGAGATCAGCCTGGGAGGG + Intronic
1190038039 X:47044023-47044045 ATGTAGAAAATAGCCTCAGAAGG + Intronic
1190053426 X:47168848-47168870 ATGTAGAGACTGAACTGGGGAGG + Intronic
1199408354 X:147489811-147489833 ATGTAGAGAATTACATGGGAGGG - Intergenic
1200899713 Y:8417181-8417203 ATGTCTATACTTGCCTGGGATGG + Intergenic
1201665274 Y:16446159-16446181 ATGTACAGAATATCCAGGGAAGG + Intergenic
1201788835 Y:17815603-17815625 ATGTGGAGACTAGCTGTGGAGGG + Intergenic
1201812718 Y:18090384-18090406 ATGTGGAGACTAGCTGTGGAGGG - Intergenic