ID: 1016977118

View in Genome Browser
Species Human (GRCh38)
Location 6:149820149-149820171
Sequence CCACAGAACAAGGGGAAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016977118 Original CRISPR CCACAGAACAAGGGGAAGCT GGG Exonic
901297166 1:8169550-8169572 CCACAGCTCAAGGGGAAGCGTGG - Intergenic
901393650 1:8964662-8964684 CCAGAGAACTGGGGGAAGCTGGG - Intronic
901494630 1:9613988-9614010 CAAGAGAACCAGGGGAAGATGGG - Exonic
902103181 1:14010939-14010961 CCAAAAAAAAAGGGGAAGCAAGG - Intergenic
902341890 1:15788958-15788980 CCACACAGCACGGGGAAGCCAGG + Intergenic
902584807 1:17432240-17432262 GCAGATAACCAGGGGAAGCTAGG - Intronic
903861146 1:26365142-26365164 CCACAGAACAAGGACAAGCTGGG - Exonic
905677633 1:39839363-39839385 TCACAGAGCAAGGCAAAGCTGGG - Intergenic
905790671 1:40787647-40787669 CCACAGAGAGAGGGAAAGCTTGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906291792 1:44624141-44624163 CCAAAGAGAAAGGGGAGGCTGGG + Intronic
906582630 1:46948848-46948870 TCACAGAACTAGGGGAGGTTGGG - Intergenic
906600978 1:47129024-47129046 CCACAGAACTGGGGGAGGTTGGG + Intergenic
906724488 1:48034015-48034037 CCACAGAACAGAGGGATCCTGGG - Intergenic
907933020 1:59017639-59017661 TCACAGGACAATGGGAAACTAGG + Intergenic
909235403 1:73147052-73147074 CCACAGACCAAGGGGCAGTAGGG - Intergenic
913308706 1:117462555-117462577 CCAGAGAACAAAGAGAAGGTTGG + Intronic
914453328 1:147812508-147812530 CCACTCAACAAGGACAAGCTTGG + Intergenic
915595247 1:156893413-156893435 CCGCACAACGAGGGGAAGCTAGG + Intergenic
915821057 1:159024269-159024291 CTACTGAAGAAGGGGAAGATGGG + Intronic
916448409 1:164895232-164895254 GCACAGAACAAGAGAAAGATGGG - Intronic
917077730 1:171222806-171222828 CTACTGAAGAAGGGGAAGATGGG - Intergenic
918703170 1:187631050-187631072 ACACAGAACAAAGGAAAGCAGGG - Intergenic
1063555506 10:7075239-7075261 GGACAGAGGAAGGGGAAGCTTGG + Intergenic
1064010201 10:11729679-11729701 CCACAGAGCCAGTGGGAGCTGGG + Intergenic
1064081145 10:12308941-12308963 CCAGAGTTAAAGGGGAAGCTGGG - Intergenic
1066632172 10:37468310-37468332 CCAGAGTTAAAGGGGAAGCTGGG - Intergenic
1067286774 10:44912743-44912765 CCAGAGCTCAATGGGAAGCTGGG + Intronic
1069121674 10:64576417-64576439 CCACAGAGCCAGTGGAAGTTGGG + Intergenic
1069658236 10:70106120-70106142 CCACAGCAAAAGGGGACTCTAGG - Intronic
1069752971 10:70756563-70756585 CCAAAGAACAAAGGAAAGGTTGG + Intronic
1070998253 10:80805747-80805769 ACACAGAACAAAGGAAAGCAGGG - Intergenic
1071573418 10:86710140-86710162 CCCCAGAAGAATGGGAAGCAAGG + Intronic
1072907780 10:99471009-99471031 CCACAAAGAAAGGGGAACCTGGG + Intergenic
1073773466 10:106760804-106760826 CCACATGACAAGGGGAAGGCCGG + Intronic
1074032289 10:109700840-109700862 TCACAGAATAAGAGGAATCTTGG + Intergenic
1074254090 10:111783052-111783074 GCACTGAACATGGAGAAGCTGGG - Intergenic
1075633913 10:124017669-124017691 ACACACATCTAGGGGAAGCTGGG + Intronic
1076453258 10:130571611-130571633 CCAAAGAACAAAGAGAAGGTTGG - Intergenic
1076771668 10:132669453-132669475 CCACAGAACGAGAGGGAGCTGGG + Intronic
1077086003 11:751365-751387 CCAAAGAACAAGAGAAAGTTGGG + Intronic
1078042600 11:7882640-7882662 CCACAGTGCAAGGGGGAGCAGGG - Intergenic
1078336137 11:10464770-10464792 CCACAGACAAAGAGGGAGCTGGG - Intronic
1078653399 11:13216425-13216447 GACCAGAGCAAGGGGAAGCTGGG + Intergenic
1079535066 11:21504192-21504214 CGACAGAATAATTGGAAGCTAGG + Intronic
1080563310 11:33484350-33484372 CCACATGACAAGGGGAATCAGGG - Intergenic
1080638242 11:34142200-34142222 ACACAGGAAAAGGTGAAGCTGGG - Intronic
1080905484 11:36540735-36540757 CCAAAGAACAAAGAGAAGATTGG - Intronic
1081612223 11:44569338-44569360 CCACAGTGGAAGGGGAAGCCCGG - Intronic
1082233087 11:49793094-49793116 CCACGGAATTAGGGGAAGTTAGG - Intergenic
1083096996 11:60261142-60261164 ACACAGAACAAAGGAAAGCAGGG - Intergenic
1083257212 11:61504064-61504086 CCAGGGAGCAAGGGGAAGCATGG - Intergenic
1083982457 11:66184094-66184116 GCACAGAAAAAGGGGAAGAAAGG - Intronic
1084496700 11:69509440-69509462 CCACAGAGCATGGGGAGGCACGG + Intergenic
1087038045 11:93773708-93773730 CCACAGAACTGGTGGGAGCTGGG - Intronic
1088785297 11:113176248-113176270 GCACAGAACAAGGACAAGCATGG + Intronic
1088899395 11:114103765-114103787 CCACAGAGCAGAGGGAGGCTTGG + Intronic
1088940794 11:114453796-114453818 TCAAACAACAAGGGGAATCTTGG - Intergenic
1089180251 11:116578667-116578689 CCACAGAGCCAGGTGAAGCCAGG - Intergenic
1089464934 11:118678976-118678998 GCACAGTTCAAGGGGCAGCTTGG + Intronic
1089466992 11:118691878-118691900 GCACAGTTCAAGGGGCAGCTTGG + Intergenic
1090220904 11:125024155-125024177 CCACGGAAGAAGAGAAAGCTGGG - Intronic
1091234707 11:134013332-134013354 CCTCACAACAATGGGATGCTGGG + Intergenic
1092203338 12:6600792-6600814 CCACAGAACAAGATGAGACTAGG - Intronic
1092205988 12:6614330-6614352 CCACAGACCAAGGAGGAGGTAGG - Intergenic
1092447209 12:8568407-8568429 CCACAGAACAGGCAGGAGCTGGG - Intergenic
1092458141 12:8662993-8663015 CCAAGGAACAAAGGGGAGCTGGG - Intergenic
1096473177 12:51891294-51891316 GCACAGAAGTAGGGGAAGATGGG + Exonic
1096806281 12:54143109-54143131 ACACAGAGCAAGGGGGAGCTGGG - Intergenic
1097078693 12:56413542-56413564 CCACAGAACCAGGGAGAGCCAGG - Intergenic
1098910261 12:76201878-76201900 TCACAGAATAGGGGGCAGCTAGG + Intergenic
1099713730 12:86264496-86264518 CCACAGAGCCAAGGGAAGCAAGG + Intronic
1101702298 12:107185622-107185644 CCAAAGAACAAAGAGAAGGTTGG - Intergenic
1101777154 12:107805844-107805866 CCAGAGAACCACGGAAAGCTGGG + Intergenic
1101851408 12:108405563-108405585 CCACAGAACAAGGGGAGATGGGG - Intergenic
1103422811 12:120802188-120802210 CCTCAGGACAAGGGGAAACATGG + Intronic
1105459650 13:20571658-20571680 CCAAAGAACAAAGAGAAGGTTGG + Intronic
1106757533 13:32837961-32837983 CCACAGAGAGAGGGGAAGCTGGG + Intergenic
1108223691 13:48265559-48265581 CCTAAGAACCAGGGGAAGCCAGG - Exonic
1110509197 13:76328978-76329000 CCATAGAAAAAGGGGAAACTGGG - Intergenic
1111345854 13:86953316-86953338 CCAAAGCACAAAGGGAAGTTTGG + Intergenic
1112029369 13:95443198-95443220 CCACAAAACATGGCCAAGCTGGG - Intronic
1113439697 13:110318554-110318576 CCACAGAAATAGGGCCAGCTGGG + Intronic
1113674262 13:112196814-112196836 CCAGAGAACTAGGGGAACCAGGG - Intergenic
1115298495 14:31857292-31857314 CCACACAACACGGGGACTCTGGG + Intronic
1119005746 14:70926203-70926225 CCACAGAACAAGGCTAACCCTGG - Intronic
1119036038 14:71231251-71231273 CCACAGACCCAGTGGGAGCTGGG + Intergenic
1119651191 14:76384675-76384697 CCAAGGAGCAAGGGGAAACTGGG - Intronic
1120226045 14:81791907-81791929 CCACAGAACAAGGGGATGGGAGG - Intergenic
1120997751 14:90429244-90429266 GCAAAGAACAAGTGGAGGCTGGG - Intergenic
1121529425 14:94641813-94641835 CAGCAGACCCAGGGGAAGCTCGG + Intergenic
1121683417 14:95813603-95813625 CCTTATAAAAAGGGGAAGCTTGG - Intergenic
1122115700 14:99526263-99526285 CCTCAGAGCAATGGGAACCTGGG + Intronic
1122605045 14:102942471-102942493 CCACAGATCAAGAGGAGGCCGGG - Intronic
1122653876 14:103243975-103243997 ACACAGAACAAAGGAAAGCAGGG + Intergenic
1124655912 15:31507145-31507167 CTACTGAAGAAGGGGAAGATGGG + Intronic
1127270973 15:57401847-57401869 CAACAGGAGAAGGGGAGGCTGGG - Intronic
1127287123 15:57541923-57541945 CAACACCACAGGGGGAAGCTGGG - Intronic
1128219045 15:65954809-65954831 CCTCAGAACAAGGGAAAACTGGG - Intronic
1128512474 15:68321858-68321880 CCTCAGCTCAAGGGGAAGATTGG + Intronic
1128745238 15:70109870-70109892 ACACAGAAAGATGGGAAGCTGGG + Intergenic
1130038701 15:80385477-80385499 ACACAGAATAATGGGAAACTAGG + Intronic
1131153174 15:90059563-90059585 CCACAGAGAAAGGGGAAGCAAGG + Intronic
1132270214 15:100517578-100517600 CCACAGATAAAGAGGAAGCTGGG + Intronic
1133384524 16:5358246-5358268 CCTTATAAAAAGGGGAAGCTTGG - Intergenic
1134295357 16:12940587-12940609 ACACAGAACAAAGGAAAGCAGGG - Intronic
1134445302 16:14326774-14326796 CCACAGTACACGGGGCTGCTGGG - Intergenic
1135131501 16:19857703-19857725 CCACTGAACAAGGGTGAACTCGG - Exonic
1136552803 16:30990429-30990451 ACACAGGACAAGGGAGAGCTCGG + Exonic
1137039446 16:35597043-35597065 CTACTGAAGAAGGGGAAGATGGG + Intergenic
1138713563 16:58996547-58996569 ACCCAGAACAAGGGGAAACGGGG - Intergenic
1139838183 16:69856845-69856867 ACACAAAACAAAAGGAAGCTGGG - Intronic
1141138758 16:81483623-81483645 CCACAAAACAGTGGGCAGCTGGG - Intronic
1142019368 16:87771418-87771440 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
1144282848 17:13743986-13744008 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
1144932908 17:18874634-18874656 TCACAGCAGAAGGTGAAGCTAGG - Intronic
1145885029 17:28376068-28376090 CCACAGAAGAACTGGGAGCTGGG + Intronic
1147187899 17:38722559-38722581 CCTCAGACCCAGGGGAAGCAAGG - Intronic
1147559235 17:41498919-41498941 CTACAGAACAAGGTGGGGCTCGG - Intergenic
1147968087 17:44204876-44204898 GCACAGAACAATGTGAAGGTAGG + Intergenic
1148211135 17:45809377-45809399 CCCCAGAGCATGGGGGAGCTGGG - Intronic
1149880994 17:60290288-60290310 CCAAAGAACAAAGAGAAGGTTGG - Intronic
1149975703 17:61263520-61263542 ACACAGAACAAGGTGAAGAGTGG + Intronic
1151315522 17:73319667-73319689 CCACAGAACCATGAGAAGGTAGG + Intergenic
1151764058 17:76122948-76122970 CCACAGAACAAGAGCACACTGGG - Intergenic
1151780434 17:76241339-76241361 ACACACAACAGTGGGAAGCTTGG + Intergenic
1152146954 17:78574124-78574146 AGAGAGAACAAGGGGATGCTCGG + Intronic
1152320892 17:79608455-79608477 CCAAAGAAAAAAGGGAACCTGGG - Intergenic
1152465632 17:80464607-80464629 CCAAAGAACCAAGGGGAGCTGGG - Intergenic
1153473007 18:5468003-5468025 GCCCAGAACAAGGAGAAGCCAGG - Intronic
1153722125 18:7915841-7915863 GCACTAAACAAGGGGAATCTAGG + Intronic
1154346093 18:13544774-13544796 GCACAGACCAAGGAGAGGCTAGG + Intronic
1157550042 18:48575120-48575142 CCACCTCAAAAGGGGAAGCTGGG - Intronic
1159510454 18:69391891-69391913 CCTCAGAAGAAGAGGAAGTTTGG - Intergenic
1161221228 19:3119136-3119158 ACACAGCCCAAGGGGCAGCTGGG - Intronic
1161597192 19:5156544-5156566 GCACAGAACACAAGGAAGCTGGG + Intergenic
1162664635 19:12199864-12199886 CCACAGAGCACTGGAAAGCTGGG + Intergenic
1162704814 19:12547602-12547624 CTACAGACCACTGGGAAGCTGGG - Intronic
1162837428 19:13330044-13330066 CCACAAAATAATGAGAAGCTAGG + Intronic
1163976932 19:20861552-20861574 CTACTGAAGAAGGGGAAGATGGG - Intronic
1164176506 19:22780030-22780052 CCACAGAACCCTGGAAAGCTGGG - Intronic
1164483126 19:28631556-28631578 CCAAAGAACAAAGAGAAGGTCGG - Intergenic
1166379964 19:42350702-42350724 CCAGGGAACAAGAGGAAGCAGGG - Intronic
1166496924 19:43309974-43309996 CTACTGAAGAAGGGGAAGATGGG + Intergenic
1167199601 19:48055159-48055181 CAACAGAGCAAGGGTCAGCTTGG + Intronic
925273496 2:2632054-2632076 GAACAGAACAAGGGTCAGCTAGG - Intergenic
925820766 2:7797526-7797548 CATCAGAAAAAGGGGGAGCTTGG + Intergenic
926322924 2:11761390-11761412 GGACAGATCAAGGGGGAGCTGGG + Intronic
927791300 2:26011854-26011876 CCAAAGAATCAGGGGAAGCCAGG - Intergenic
928389719 2:30899819-30899841 CCACAGACCACGAGGGAGCTCGG + Intergenic
929016344 2:37500560-37500582 CCACACAACAAGGCAGAGCTGGG - Intergenic
931150386 2:59566531-59566553 CCACAGAACAGGGGAAATCCAGG - Intergenic
931159079 2:59668162-59668184 CCACCGCACAAAGGGAATCTTGG - Intergenic
931237653 2:60425035-60425057 CCAAAGAAAAAGGTCAAGCTGGG + Intergenic
931762808 2:65432125-65432147 CCGCAGCAGAAGGGGAAGCAGGG + Exonic
937872408 2:126795683-126795705 CCTCAGAGGAAGGGGAAGATGGG - Intergenic
938576734 2:132611112-132611134 ACTCAGAACACGGGGAAGTTGGG - Intronic
938728254 2:134125720-134125742 CCACATTCCAAGGTGAAGCTGGG - Intronic
939122138 2:138129951-138129973 CCAAAGAACAAAGAGAAGATTGG + Intergenic
941857771 2:170248052-170248074 GCACAGAAAGAGGGGGAGCTGGG - Intronic
944022878 2:195126388-195126410 CCACAGACCCAGTGGGAGCTAGG - Intergenic
946873569 2:224106642-224106664 ACTCAGAACAAGAGAAAGCTGGG - Intergenic
948495561 2:238346375-238346397 CCACAGCACAGGGGGTAGCCTGG - Intronic
1168792066 20:584717-584739 CCACAGGAGAAGGGGAAAATGGG + Intergenic
1168975478 20:1962505-1962527 CCACAGACAAAGGGGAAGCCTGG + Intergenic
1169035853 20:2451474-2451496 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
1169560119 20:6790819-6790841 CCAAAGAACAAAGAGAAGGTTGG - Intergenic
1169663344 20:8005770-8005792 CCGCAGAACAACGGAAAGTTTGG + Intronic
1170221424 20:13946590-13946612 CCGCAGAGCCAGTGGAAGCTGGG + Intronic
1172354858 20:34272584-34272606 TCACAGAACACAGGGAAGCAAGG + Intergenic
1174488080 20:50873689-50873711 CCACAGAGGCAGGGGCAGCTGGG + Intronic
1174505466 20:51014959-51014981 GCACAGAGCGAGGGGAAGCTGGG + Intronic
1174953417 20:55067596-55067618 ACACAGAACAAGGAAAAGCAGGG - Intergenic
1175058476 20:56219876-56219898 ACACAGAACAAAGGAAAGCAGGG + Intergenic
1175303434 20:57959321-57959343 ACAATGAACAAGGAGAAGCTGGG - Intergenic
1175730976 20:61353709-61353731 CCAGAGGAAAAGGGGAAGCAGGG - Intronic
1176886884 21:14267320-14267342 ACACAGAAAAAGCTGAAGCTAGG - Intergenic
1178502988 21:33141003-33141025 CATCAGAGCAAGTGGAAGCTGGG + Intergenic
1180026824 21:45169252-45169274 CCACCCAACAAGGGGACTCTGGG + Intronic
1180659234 22:17451440-17451462 GCATAGCTCAAGGGGAAGCTAGG + Intronic
1182931275 22:34176621-34176643 CCACAGATCTAAGGGAGGCTGGG + Intergenic
1183056265 22:35308052-35308074 CCCCAGAACAAGAGGGAACTTGG + Intronic
1184128714 22:42504612-42504634 CCACACATCATGGGGGAGCTTGG + Intergenic
1184137509 22:42557927-42557949 CCACACATCATGGGGGAGCTTGG + Intronic
1184980498 22:48092078-48092100 GCACAGAAGAAAGGGAGGCTTGG - Intergenic
1185222775 22:49637273-49637295 CCTCAGAACCAGGAGCAGCTCGG + Intronic
953778295 3:45842077-45842099 CCACAGAAAATGGGGAAGGAGGG + Exonic
955163694 3:56490023-56490045 GCACAGGACCAGGGGAAGGTTGG - Intergenic
956256358 3:67287071-67287093 CCCCAGAACAAAGGGAAGGAAGG - Intergenic
956379709 3:68652845-68652867 TCTGAGAACATGGGGAAGCTGGG + Intergenic
957333511 3:78796590-78796612 CCACGGAATTAGGGGAAGTTAGG - Intronic
959840196 3:110966454-110966476 CTACTGAAGAAGGGGAAGATGGG + Intergenic
960672420 3:120166293-120166315 CCACAGGACAAGGGGACAGTGGG + Exonic
961311596 3:126005527-126005549 GCACAGAGCCAGGGGAGGCTGGG - Intergenic
961378664 3:126483145-126483167 CCAGAGAATGAGGGGAGGCTTGG - Intronic
962633252 3:137301357-137301379 TCATAGAACAATGGGAAGCTAGG - Intergenic
962754423 3:138457212-138457234 CCACAGCACAGGGTGGAGCTGGG - Intronic
962996181 3:140631047-140631069 CCAGAGTACAAGGAGAAGCTGGG + Intergenic
963040296 3:141065315-141065337 ACACAGAACAAGGTGCAGCAGGG - Intronic
963442092 3:145354076-145354098 ACACAGAACAAAGGAAAGCAGGG + Intergenic
963851699 3:150216282-150216304 CCACAAAAAAAGGGGGAGCCAGG + Intergenic
963878472 3:150502349-150502371 CCACAAAACATGGGGACGATGGG + Intergenic
964517362 3:157527163-157527185 CTACAGACAAAGGGGAAGATTGG - Intronic
965554747 3:170007383-170007405 GCACACAAGAAGGAGAAGCTGGG + Intergenic
966779664 3:183573273-183573295 CCACAGAGAAAGGGGCAGCCTGG - Intergenic
966945925 3:184777090-184777112 GCACAGAACAAGGAGAGGCCTGG + Intergenic
967118814 3:186364646-186364668 CAACAGGACAAGGGCAATCTAGG + Intergenic
967720507 3:192811155-192811177 CCACAGAGTCTGGGGAAGCTAGG - Intronic
969841879 4:9888811-9888833 ACATAGAACAAGGGGAAGGAGGG - Intronic
970100505 4:12515731-12515753 TCACAGCAGAAGGGGAAGCAAGG - Intergenic
970166129 4:13240382-13240404 CCACAGAACACGAGGAAAATGGG + Intergenic
970234501 4:13944846-13944868 CATCAGAACAATGGGAAGTTTGG - Intergenic
971598382 4:28561141-28561163 CCACAGAACATGGGGTAAATTGG - Intergenic
973335046 4:48947627-48947649 CCAAAGAACAAAGAGAAGGTTGG - Intergenic
973685425 4:53365349-53365371 CGACCGGACAAGAGGAAGCTGGG - Exonic
975266965 4:72381292-72381314 CCAGAGACCAGTGGGAAGCTGGG - Intronic
977435905 4:96993935-96993957 GAAGAGAAAAAGGGGAAGCTGGG + Intergenic
977781209 4:100983162-100983184 CCACAAAACAAGGAGACACTGGG - Intergenic
977867563 4:102047911-102047933 CCACAGAAAAAGGGGAGGAGAGG + Intronic
978329929 4:107601369-107601391 CCACAGAGCCTGGGAAAGCTGGG + Intronic
978627683 4:110705586-110705608 CCAAAGAAGAAGAGGAAGCAAGG - Intergenic
980480041 4:133376590-133376612 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
980569832 4:134600260-134600282 GCACAGATCAAGGGTAAGATAGG - Intergenic
980917244 4:139045122-139045144 ACACACAATAAGGGGAATCTTGG - Exonic
982092537 4:151892842-151892864 CAAAAGAACAAGAGGAAGCCTGG - Intergenic
982180983 4:152748425-152748447 CCACAGAGCCAGCGGGAGCTGGG + Intronic
984562568 4:181287971-181287993 ACACAAAACAAGGGGAAGAAAGG - Intergenic
986923414 5:12716861-12716883 CCACAGAGCCAGCGGGAGCTGGG + Intergenic
987289682 5:16496621-16496643 CCAAAAAAGAAAGGGAAGCTGGG + Intronic
987879914 5:23730106-23730128 CCACAGAACTAGTGGCAGCTGGG - Intergenic
988553348 5:32216464-32216486 CCACAGACCAAGGAGGAGCAGGG - Intergenic
989199176 5:38746520-38746542 ACACAGAAGAAGGAGCAGCTTGG + Intergenic
990848174 5:60168471-60168493 TCACAGAAGAAGGGGCAGCATGG - Intronic
993616782 5:90122676-90122698 CTCCAGAACTAGGGGAAGCTAGG + Intergenic
995648145 5:114336866-114336888 ACACAGAGCAAGGGGAAGAGAGG + Intergenic
996110677 5:119562954-119562976 CCAAAGAACAAAGAGAAGATTGG - Intronic
998151057 5:139757785-139757807 CCCCAGAACTAGGGTATGCTGGG - Intergenic
999347181 5:150834286-150834308 CTACTGAAGAAGGGGAAGATGGG + Intergenic
1000496741 5:161993491-161993513 GGACTGAACAAGGGGAAGTTGGG - Intergenic
1001776114 5:174330265-174330287 CCAAAGGACAAGAGGAAGATGGG + Intergenic
1002189909 5:177472950-177472972 CCACAGCACAAAGGAAAGCGAGG - Exonic
1002327765 5:178420731-178420753 CTACAGCACAAGGGGAATGTGGG + Intronic
1002581399 5:180211386-180211408 TCACAGAGCAAGGGTGAGCTGGG - Intergenic
1004737413 6:18421591-18421613 CCACAGACCAAGGGTTAGCACGG + Intronic
1006049258 6:31328573-31328595 ACCCAGAACAAGGGAAAGCAGGG + Intronic
1006240369 6:32672760-32672782 GCACACAGCAAGGGGACGCTGGG - Intergenic
1006389164 6:33748470-33748492 CAAGAGAACAAGGGGTGGCTGGG + Intergenic
1007338641 6:41173826-41173848 CCACAGCACACTGGGCAGCTCGG + Intergenic
1007476745 6:42124314-42124336 ACACAGAACAAGGGAACTCTGGG + Intronic
1008454194 6:51689971-51689993 TCACAGAACTAGGGAAAACTAGG + Intronic
1011627029 6:89291132-89291154 CCACAGAATCAGAGGAACCTAGG - Intronic
1012553887 6:100489396-100489418 CTACACAACAAGGAGAAACTAGG - Intergenic
1014104951 6:117551088-117551110 TCCCAGAACAAGGAGAGGCTGGG - Intronic
1014220688 6:118795895-118795917 TCTCAGTTCAAGGGGAAGCTGGG + Intergenic
1015138990 6:129908647-129908669 TCACAGGACAAGGGAATGCTAGG + Intergenic
1016428057 6:143955379-143955401 CCACTCTACAAGGGGAAGGTGGG + Intronic
1016977118 6:149820149-149820171 CCACAGAACAAGGGGAAGCTGGG + Exonic
1017528858 6:155267440-155267462 CCAAAGAACAAAAGGAAGGTTGG + Intronic
1018025167 6:159800154-159800176 CAGCAGCACACGGGGAAGCTGGG + Intergenic
1018707872 6:166476102-166476124 CCCTAGAACAAGGGGAAATTTGG + Intronic
1023302567 7:38789477-38789499 ACAGAGACCAAGGAGAAGCTTGG + Intronic
1024924404 7:54598138-54598160 CAACAAAATAAGGGGAAGATAGG + Intergenic
1026000887 7:66558309-66558331 CCAGAGTACAAGAGGAGGCTGGG + Intergenic
1026427095 7:70306126-70306148 CCAAAGAACAAAGGAAAGATTGG + Intronic
1026518755 7:71096519-71096541 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
1030621473 7:111795507-111795529 ACACAGAACAAAGGAGAGCTGGG + Intronic
1032322976 7:130901174-130901196 CCCCAGAACAAGGCAAAACTGGG + Intergenic
1033308528 7:140242153-140242175 CCACTGAAAAACAGGAAGCTGGG - Intergenic
1034308619 7:150067777-150067799 CCACACAACAAGGGGGTGGTGGG + Intergenic
1034321187 7:150184204-150184226 TCACTGAACAAGGAGAAGCAGGG - Intergenic
1035339406 7:158150916-158150938 CCACACAACACCGAGAAGCTGGG + Intronic
1035746692 8:1966248-1966270 CCACAGAGCCAGGTGGAGCTGGG + Intergenic
1036671355 8:10790609-10790631 CCAAAGAGAAAGGGGCAGCTTGG - Intronic
1036987981 8:13557927-13557949 CTAAAGAACAAGGAGAAGGTTGG + Intergenic
1037487205 8:19358826-19358848 CCAGAAAACAAGGGCACGCTGGG - Intronic
1037970386 8:23167604-23167626 CCAAAGAACAAAGAGAAGTTTGG - Intergenic
1041964569 8:63660167-63660189 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
1046717249 8:117581175-117581197 CCAAAGAACAAAGAGAAGGTTGG + Intergenic
1047708766 8:127528714-127528736 CCTTAGAACAAGAGGAAGATTGG + Intergenic
1048318350 8:133378463-133378485 CCAGGGCAAAAGGGGAAGCTCGG - Intergenic
1050150557 9:2615730-2615752 CGACAGAGCAAGGACAAGCTGGG - Intergenic
1050847328 9:10238442-10238464 CCAAAGAACAAGGAGAAGGTTGG - Intronic
1051159284 9:14187949-14187971 CCCCACAACAATGGGAAGCTAGG + Intronic
1051405107 9:16728417-16728439 GCACAGGGCAAGGGGAAGCTAGG + Intronic
1051644207 9:19251342-19251364 GCACACAGCAAGGGGATGCTGGG + Intronic
1051728525 9:20113907-20113929 CCACTGAACAACAGGCAGCTTGG + Intergenic
1053164780 9:35836673-35836695 GCCCAGACCAAGGGGGAGCTGGG + Intronic
1055717562 9:79134740-79134762 TCACAGAAGAAGGGGAAGATGGG - Intergenic
1056947127 9:91007391-91007413 CCATGGGACAAGGAGAAGCTGGG - Intergenic
1057221448 9:93259856-93259878 CCACAGAGCCATGGGAAGGTAGG - Intronic
1057278644 9:93694027-93694049 CCTTATAACAAGGGGAAACTTGG + Intergenic
1057719139 9:97518226-97518248 CCTCAGAAAAAGGGGAAATTTGG + Intronic
1058835816 9:108857736-108857758 CAACAGAAAAAGGGGAAGAGCGG + Intergenic
1059489098 9:114652500-114652522 GCATAGGACAAGGGGAATCTGGG + Intergenic
1059583374 9:115577070-115577092 CGATAACACAAGGGGAAGCTGGG - Intergenic
1060247192 9:121956976-121956998 CCCCAGAAGAAGGGGAGTCTGGG + Intronic
1060371402 9:123076046-123076068 TCTCAGAAAAAGGGGAAGCTAGG + Intronic
1062192092 9:135253341-135253363 CCACAGCACAAGGGAGAGCCAGG + Intergenic
1062548086 9:137072701-137072723 CCACAGACCAAGGGCCAGCTGGG - Intergenic
1185845076 X:3430410-3430432 GCACAGATCAAGGGGATACTTGG - Intergenic
1188684242 X:33049643-33049665 CCAGAGAACAAAAGGAAACTTGG + Intronic
1189516403 X:41717207-41717229 ACACAGAACAAAGGAAAGCAGGG - Intronic
1189566118 X:42242893-42242915 GCACAGAACAAGCAGAAGCCTGG - Intergenic
1189637233 X:43023778-43023800 GCACACAACATGGGGAACCTGGG + Intergenic
1191594003 X:62922761-62922783 ACAGAGAGCAAGGGAAAGCTTGG + Intergenic
1191921234 X:66259167-66259189 CCACATCAGAAGGGAAAGCTAGG - Intronic
1192182271 X:68923519-68923541 CCACAGAACAAGATGAATCTTGG + Intergenic
1198437740 X:136633423-136633445 CCAAAGAACAAAGAGAAGGTTGG - Intergenic
1199638092 X:149832609-149832631 CTACTGAAGAAGGGGAAGATGGG - Intergenic
1200735038 Y:6784988-6785010 CTACTGAAGAAGGGGAAGATGGG - Intergenic
1201910342 Y:19127492-19127514 CCAGAGAAGAATGGGAATCTTGG - Intergenic