ID: 1016977975

View in Genome Browser
Species Human (GRCh38)
Location 6:149827708-149827730
Sequence GTCCTTGGTGACCACTGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016977975_1016977981 21 Left 1016977975 6:149827708-149827730 CCACGACAGTGGTCACCAAGGAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1016977981 6:149827752-149827774 CTTATATGATACCTGATCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 92
1016977975_1016977977 -7 Left 1016977975 6:149827708-149827730 CCACGACAGTGGTCACCAAGGAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1016977977 6:149827724-149827746 CAAGGACCTCTCCAGCTACCTGG 0: 1
1: 0
2: 0
3: 16
4: 197
1016977975_1016977982 26 Left 1016977975 6:149827708-149827730 CCACGACAGTGGTCACCAAGGAC 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1016977982 6:149827757-149827779 ATGATACCTGATCCCAGGCCAGG 0: 1
1: 0
2: 3
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016977975 Original CRISPR GTCCTTGGTGACCACTGTCG TGG (reversed) Intronic
901451463 1:9339032-9339054 GCCCTTGGTTACCACTGGCCTGG - Intronic
903302789 1:22391036-22391058 CTCCCTGGTCACCACTGTCTAGG - Intergenic
905541234 1:38762101-38762123 GTCATTGTTGGCCACTGTAGAGG - Intergenic
908940873 1:69431798-69431820 GGCCCTGGAGACCACTGTCCTGG - Intergenic
916785233 1:168082310-168082332 GTCCTTGGTCACCAAGGCCGTGG + Exonic
1062874312 10:932216-932238 GTCCTGGGTGGCCAGGGTCGGGG - Intergenic
1068573116 10:58653420-58653442 GTCTTTGGTGTCCACAGTCTTGG - Intronic
1069795738 10:71050696-71050718 GTCGCTGGTGACCACAGTCCAGG - Intergenic
1075481859 10:122789017-122789039 GTCATTGTTGACCAGTGTCTAGG - Intergenic
1075861279 10:125678998-125679020 GTCTTTGGTGGCCACAGTCTGGG + Intronic
1077194913 11:1274657-1274679 GTCCTTAGTGACCGCTGCCACGG + Exonic
1077611471 11:3645551-3645573 GGCCTTGGTGACCAGTGTCAGGG - Intronic
1082626139 11:55488470-55488492 GCCCCTGGTAACCACTGTTGTGG + Intergenic
1083990104 11:66241618-66241640 TTCTTTGGTGACCACAGTCATGG - Exonic
1084483783 11:69436596-69436618 GAACTTGGTGACCACTGTAAAGG - Intergenic
1090826545 11:130391192-130391214 GTGCTAGGTAACCACTGTCCCGG + Intergenic
1096869211 12:54582988-54583010 CTCCTTGCTCACCATTGTCGAGG - Intronic
1097202768 12:57293573-57293595 GTAATTGGTGAACACTGTCCAGG + Intronic
1106101537 13:26697815-26697837 GTCCTCTGTGACCACTCTGGAGG + Intergenic
1107769662 13:43776322-43776344 GTGCTTGGAAACCACAGTCGAGG + Intronic
1111924285 13:94446172-94446194 GTTATTGGTGTCCACTGTTGAGG - Intronic
1113078123 13:106488550-106488572 GACCTTGGTGCACACGGTCGAGG + Intergenic
1113750399 13:112773037-112773059 GTCCATGGTGATCTCTGTCTGGG + Intronic
1122662892 14:103309779-103309801 GGCCCTGGGGACCACTGTGGTGG - Intergenic
1122865139 14:104600346-104600368 CTCCATGGTGACCGCTGTCCTGG + Intronic
1122872183 14:104643861-104643883 CTCCTTGGAGACCAATGTCTGGG - Intergenic
1123019902 14:105392810-105392832 CTCCTTGGTGACCACGGTCATGG - Exonic
1123404685 15:20012668-20012690 GTCCGTGCTGGCCACTGTTGAGG + Intergenic
1123514018 15:21019315-21019337 GTCCGTGCTGGCCACTGTTGAGG + Intergenic
1130886519 15:88097044-88097066 GTGGTTAGTGACCACTGTTGTGG - Intronic
1131141455 15:89979846-89979868 GTCCTTAGTGACCAATGTGGAGG - Intergenic
1132381022 15:101366784-101366806 GTCCTTAGTGAGCACTCTCTGGG - Intronic
1132551562 16:555857-555879 GACCTTGGTGGCAGCTGTCGGGG + Intergenic
1132698110 16:1210870-1210892 GTCCCTGGTGGACATTGTCGTGG + Exonic
1135522184 16:23186150-23186172 GTCCCTGGAGACCACAGTCTGGG - Intronic
1147159568 17:38562353-38562375 GTCCTTGGTGACCAGCCCCGTGG - Intronic
1153593324 18:6697917-6697939 GTCCATGGCGACTACTGTTGTGG + Intergenic
1154048048 18:10926194-10926216 TTCCTGGCTGACCACTGCCGGGG + Intronic
1163263548 19:16205334-16205356 GGCCTTGCTGAGCACTGTCCCGG - Intronic
1163340335 19:16702196-16702218 ATCCCTGGTGACCACAGACGTGG + Intergenic
1163990522 19:20995065-20995087 GGCCTTGGTGAGTACTATCGTGG - Intergenic
926038732 2:9655788-9655810 ATCTTTGGTGACCACAGTCAAGG - Intergenic
937409306 2:121659132-121659154 GTCATTGATGACCACTGCCTAGG + Intergenic
940301951 2:152184721-152184743 GTCCTTGGGGACCAGTGGCTGGG - Intergenic
1176677982 21:9798833-9798855 GTCCTTGCTGACGACTGGGGAGG + Intergenic
1179333384 21:40427228-40427250 GTCCTAGCTGATCACTGTCCTGG + Intronic
1179829085 21:43984898-43984920 GTCCGTGCTGGCCACTGTCGGGG + Exonic
1181776026 22:25160753-25160775 GTCCTTGGAGCCCACTGAGGGGG + Intronic
1183091754 22:35527023-35527045 GCCCTTGGGGAGCACTGTGGAGG - Intergenic
1183492319 22:38123156-38123178 GTCCTTGGTGGCCACACCCGAGG + Exonic
950193025 3:10991531-10991553 GACCTTGGTGAGCACTGCCCTGG + Intergenic
950584298 3:13881408-13881430 GTCCACGGTGCCCACTATCGTGG - Intergenic
950928951 3:16770350-16770372 GGCCTTGGTGTCCTCTGTCGTGG - Intergenic
953494925 3:43377703-43377725 GTGCTTGGTGTCCACTGGCCTGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
961745562 3:129061774-129061796 GTCCTTGGTGGCCTCTGCTGTGG - Exonic
974867849 4:67602863-67602885 GCCCATGGTGACCATTGTCTGGG + Intronic
983650892 4:170035442-170035464 GTCCTTGGTCACCAGGGTTGAGG + Intergenic
994322334 5:98407773-98407795 TTCCTTGGTGAACAGTGTAGTGG - Intergenic
994344207 5:98665100-98665122 GTTTTTGGTGACCCCTGTTGGGG - Intergenic
994891983 5:105647798-105647820 ATCCTTGGTGACCACAGCCTGGG - Intergenic
995826285 5:116303434-116303456 CTCCTTCCTGACCACTGTTGTGG + Intronic
997614313 5:135236146-135236168 GTCCATGGTCACTACTGTCAGGG + Intronic
1000585884 5:163098336-163098358 TTCCTGGGTGTCCACTGTCCAGG - Intergenic
1004381340 6:15135209-15135231 GTCCTTGGTTACCACCCTCCCGG + Intergenic
1016488660 6:144571878-144571900 GTCCTTGGTGACCTCTCTTCTGG + Intronic
1016705965 6:147108469-147108491 TACCTTGGTGACCACTCTAGAGG + Intergenic
1016977975 6:149827708-149827730 GTCCTTGGTGACCACTGTCGTGG - Intronic
1019019952 6:168910187-168910209 GGCGTTGGTGGTCACTGTCGTGG + Intergenic
1019068920 6:169325685-169325707 GTCCATGGTGCCCACTGTACAGG - Intergenic
1021483522 7:21144100-21144122 CTCCGAGGTGACCACTGTCCTGG + Intergenic
1025797509 7:64753285-64753307 GGCCTTGGTGACTATTATCGTGG - Intergenic
1033254101 7:139784645-139784667 GTCATTCCTGACCACTGTCTCGG - Intronic
1035583116 8:752605-752627 GTCCTTGCTGAGCACAGTGGGGG + Intergenic
1037649227 8:20821737-20821759 GTCCTTGGTGCCCTCTGCCAGGG + Intergenic
1044427971 8:92075082-92075104 ACCCTTGGTGACCACTGTTCTGG - Intronic
1048602680 8:135934741-135934763 GTGCTTGGTGCCCACTGTGGGGG + Intergenic
1055264748 9:74481821-74481843 GTCCTTGGTGACCTCTAGAGGGG - Intergenic
1056580502 9:87885834-87885856 GTCCCTGGCGACCACAGTCTGGG + Exonic
1058247923 9:102654080-102654102 GTTCTGGGTGACCACTGGCTGGG + Intergenic
1060258963 9:122057094-122057116 GTTCTTGGCGCCCACTGTCTAGG - Intronic
1186734600 X:12448002-12448024 GTCCTTGTAGAGGACTGTCGTGG + Intronic
1188751796 X:33913520-33913542 GGCCTTGGTGTCCTCTGTCATGG - Intergenic
1192615781 X:72620740-72620762 GTCCTTGGTGACCAAGGCCAAGG - Exonic
1194195092 X:90882860-90882882 GCCCTTGCTGCCCACTGTCTGGG - Intergenic
1197426132 X:126298745-126298767 GTCCTTGGTGTGAACTGTCTAGG - Intergenic
1197640491 X:128961499-128961521 GTTCTTGGTGACCCCTGTAAGGG + Intergenic
1199034950 X:143039354-143039376 GTCCTTGGTTAAAACTGTGGTGG + Intergenic
1200829021 Y:7673007-7673029 GGCCTTGGTGCCCACTCTGGCGG + Intergenic