ID: 1016979059

View in Genome Browser
Species Human (GRCh38)
Location 6:149837645-149837667
Sequence GGAGTCTGAAGAATTAAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016979059_1016979067 -1 Left 1016979059 6:149837645-149837667 CCCGACTTAATTCTTCAGACTCC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1016979067 6:149837667-149837689 CTCAGGGGCTCTTGGTCTGAGGG 0: 1
1: 1
2: 3
3: 30
4: 225
1016979059_1016979064 -9 Left 1016979059 6:149837645-149837667 CCCGACTTAATTCTTCAGACTCC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1016979064 6:149837659-149837681 TCAGACTCCTCAGGGGCTCTTGG 0: 1
1: 1
2: 2
3: 23
4: 202
1016979059_1016979068 25 Left 1016979059 6:149837645-149837667 CCCGACTTAATTCTTCAGACTCC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1016979068 6:149837693-149837715 TTCTCCATGCTTGCCTTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 186
1016979059_1016979066 -2 Left 1016979059 6:149837645-149837667 CCCGACTTAATTCTTCAGACTCC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1016979066 6:149837666-149837688 CCTCAGGGGCTCTTGGTCTGAGG 0: 1
1: 0
2: 2
3: 25
4: 283
1016979059_1016979069 28 Left 1016979059 6:149837645-149837667 CCCGACTTAATTCTTCAGACTCC 0: 1
1: 0
2: 0
3: 14
4: 154
Right 1016979069 6:149837696-149837718 TCCATGCTTGCCTTGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016979059 Original CRISPR GGAGTCTGAAGAATTAAGTC GGG (reversed) Intronic
902701645 1:18176307-18176329 GGTGTCTGAAAAATGAAGCCAGG - Intronic
905342431 1:37288421-37288443 AGAGTCTACAGAATGAAGTCCGG - Intergenic
908561819 1:65313556-65313578 TGAGTCAGAAGACCTAAGTCTGG - Intronic
908851774 1:68384081-68384103 GGAGTCTGGAGAATCAGGTAGGG + Intergenic
914865032 1:151419812-151419834 AGAGACTCAAAAATTAAGTCAGG + Intronic
915686630 1:157640692-157640714 GGAGTCTGCATTTTTAAGTCAGG - Intergenic
915832823 1:159146867-159146889 GTGGTCTGAAGAATGAAATCTGG - Intronic
917350514 1:174072568-174072590 CGAGGTTGAAGAGTTAAGTCCGG - Intergenic
917494278 1:175525870-175525892 GGAGTTTCAAGATTTAATTCTGG + Intronic
917613304 1:176711778-176711800 GGAGTGTGAAGATATAAGTAAGG - Intronic
918277019 1:182962731-182962753 GGAGCCTGAAGCATTCAGCCAGG + Intergenic
920626865 1:207611156-207611178 GGAGTGGGAAGAATTAGGACTGG + Intronic
920720809 1:208385096-208385118 CCAGTGTGAAGAACTAAGTCTGG + Intergenic
922123362 1:222697780-222697802 TGAATCTAAAAAATTAAGTCTGG - Intronic
923373428 1:233335595-233335617 GGAGTGCTAAGAATTAAATCTGG + Intronic
924678445 1:246204980-246205002 GGTATCTCAGGAATTAAGTCTGG - Intronic
1062908714 10:1198583-1198605 GGAGGCTGAAATATTTAGTCAGG + Intronic
1065993490 10:31034724-31034746 GGGTTCTGAAGTATGAAGTCTGG - Intergenic
1067718409 10:48707625-48707647 GGAGTCTGAAGACATAATGCTGG + Intronic
1068437702 10:57013944-57013966 GAAGTCCAAAGAATTTAGTCTGG + Intergenic
1070859249 10:79637579-79637601 GTAGACTGAGGAATCAAGTCAGG + Intergenic
1072276162 10:93825528-93825550 GGAGACTGTTGAAGTAAGTCTGG + Intergenic
1073821969 10:107274421-107274443 GGAGACTGAAGAAATTAGACAGG - Intergenic
1076315279 10:129535459-129535481 GGAGGCTGAAGAATAGAGCCTGG - Intronic
1076504431 10:130962627-130962649 GGAGTCAGAAGAGTGGAGTCGGG - Intergenic
1076523869 10:131098597-131098619 GCAGTCTGAATAATTAAACCTGG + Intronic
1077345783 11:2051665-2051687 GGAGTATGTAGAATGGAGTCAGG - Intergenic
1083474090 11:62904448-62904470 AGAGGCTGAAGAATTAAGTAGGG + Intergenic
1083517962 11:63278399-63278421 GGAGTCTGAAGAAATATCACAGG + Intronic
1085184840 11:74566749-74566771 GGATTGTGGAGAATTGAGTCTGG + Intronic
1086594207 11:88551840-88551862 TGACTCTGAAGAATTAACACTGG + Intronic
1086607837 11:88718109-88718131 AGAGTTTTAAGAATTAATTCTGG - Intronic
1087998981 11:104851071-104851093 GGAGTTTGAAGAATAAAATATGG - Intergenic
1090076124 11:123581053-123581075 GGAGTCTGGAAGATTAAGTAAGG - Intronic
1092865382 12:12756043-12756065 CAAGTCAGAAGAATGAAGTCTGG + Intronic
1095158642 12:38889533-38889555 TGAGGCTGAAAATTTAAGTCAGG + Intronic
1096080777 12:48830912-48830934 GGAGTGTGAAGAATGAAGCTAGG - Intronic
1096588635 12:52642735-52642757 AAAGTCTCAAGAATTAAGGCCGG + Intergenic
1097285945 12:57877467-57877489 GAAGCCTGAAGATTTAAGACAGG + Intergenic
1097296904 12:57975223-57975245 GGACTCTGAAGCATTATGTTAGG + Intergenic
1098477954 12:70927308-70927330 GGATTTTGCAGAATTAAGTAGGG + Intergenic
1099008715 12:77265237-77265259 TGAGACTGGAGAATTAAGTAAGG + Intergenic
1099223108 12:79936942-79936964 GGAATCTGAAGATTTCATTCAGG + Intergenic
1100232638 12:92624436-92624458 AAAGTTTGAAGAATTAGGTCAGG - Intergenic
1103708734 12:122895607-122895629 TGGGTCTGAAGACTTAAGGCTGG - Intronic
1104266023 12:127233135-127233157 GGGGTCTGATGAATGAAGTTGGG + Intergenic
1104287670 12:127439890-127439912 GAAGTGTGTAGAATGAAGTCTGG + Intergenic
1107677772 13:42814663-42814685 GGAGTGTGAATGGTTAAGTCAGG - Intergenic
1108605767 13:52037043-52037065 GAAATCTGAAGAATTAAGGGAGG - Intronic
1111646866 13:91042145-91042167 GAAGTCTGAACAATTGACTCAGG + Intergenic
1111655297 13:91144188-91144210 GATCTCTGAGGAATTAAGTCAGG + Intergenic
1115080003 14:29438650-29438672 AGAGTCTGAAGTGTTAATTCTGG + Intergenic
1115449058 14:33525374-33525396 GAAGACAGAAGAATGAAGTCAGG - Intronic
1115872878 14:37825033-37825055 GGAGTGTAAAGAATTGAGTCAGG + Intronic
1116343581 14:43758214-43758236 GGAGACTGAACAATTAAGAATGG + Intergenic
1117728099 14:58694051-58694073 GGAGGCTGAAGAAATAGGTCCGG + Intergenic
1118593913 14:67421428-67421450 GGAGTTTGAAGAATAAAGGTTGG + Intergenic
1120798202 14:88659519-88659541 TGACTCTTAATAATTAAGTCAGG + Intronic
1124042253 15:26116318-26116340 GGAGTCTGCAGAAGTATGTGAGG - Intergenic
1125036252 15:35127432-35127454 GGGGTCTGTAGACTTAAGACAGG - Intergenic
1127509920 15:59630326-59630348 GGACCCTTAAGAATTAAGCCTGG - Intronic
1130624168 15:85496321-85496343 GGAGGCTGAAAATGTAAGTCTGG - Intronic
1132626031 16:892016-892038 AGAGCCTGAAGAATAAAGTCAGG + Intronic
1133871255 16:9688450-9688472 GGAGCCTGAAAAACTAATTCTGG + Intergenic
1135661551 16:24301394-24301416 GGAGGTTGAAGAATTAACTCTGG + Intronic
1136101460 16:27999641-27999663 GTATTGTGAAGAATTAAGTTAGG - Intronic
1141128169 16:81415982-81416004 GGAGGCTGAAGACTGCAGTCAGG + Intergenic
1141874580 16:86814196-86814218 GGAGTGTGGATAATTAAATCAGG + Intergenic
1142921445 17:3190659-3190681 GGATTAGGAAGAATTCAGTCAGG - Intergenic
1145275703 17:21428622-21428644 GGAGTCTTAAAAATTAAGGATGG - Intergenic
1145313552 17:21714530-21714552 GGAGTCTTAAAAATTAAGGATGG - Intergenic
1145711998 17:26986507-26986529 GGAGTCTTAAAAATTAAGGATGG - Intergenic
1146561174 17:33871748-33871770 GGAGGCTGATGAATTATGTATGG + Intronic
1146989390 17:37254406-37254428 GAAGTTTGTAGAAGTAAGTCAGG - Intronic
1148565480 17:48630625-48630647 TGAGTCTGAAGAAATACCTCTGG - Intronic
1150608063 17:66711380-66711402 AGAGTGAGAAGGATTAAGTCAGG - Intronic
1153380608 18:4434935-4434957 GGAGTATTAAGAGTTAAGGCTGG + Intronic
1154510959 18:15101486-15101508 GAACTTTTAAGAATTAAGTCTGG - Intergenic
1155288011 18:24311303-24311325 TCAGTCTGAATAATTACGTCAGG - Intronic
1157384714 18:47251225-47251247 GGAGTCGGGAGAACTAAGTTGGG - Intergenic
1158517826 18:58145311-58145333 ACAGTCTGAAGAATCAAATCTGG + Intronic
1158651022 18:59285906-59285928 GGAGTCGGAAGTGTTAAATCAGG - Intronic
1159850403 18:73520486-73520508 GTAGTCTGAAAAATTAAGAAGGG - Intergenic
1160414800 18:78701135-78701157 AGAGTCCGAGGAATGAAGTCGGG + Intergenic
1162134585 19:8547623-8547645 GGAGACTGAGGAAGTAAGTCAGG - Intronic
1168366176 19:55789721-55789743 GGATTCTGAAGAATTATGTTAGG + Intronic
1168447451 19:56432697-56432719 AGATTCTGAATGATTAAGTCTGG - Intronic
930532093 2:52601602-52601624 GAAGTATGAAGAATTAACTGGGG - Intergenic
931058247 2:58497268-58497290 GGAGGCTGAAGTAATAAGTAAGG - Intergenic
932810282 2:74819782-74819804 GGAGACTGAATCATTAATTCTGG + Intergenic
935378574 2:102425375-102425397 GGAGTCTCAGGAATCAAGTAGGG - Intronic
935440939 2:103094740-103094762 GGTGTTTGCAGAATTAGGTCAGG + Intergenic
938506171 2:131885948-131885970 GAAGTTTTAAGAATTAAGTCTGG - Intergenic
941434636 2:165454022-165454044 TGAGTCTGAAGACTTAAAACGGG + Intergenic
942334028 2:174861453-174861475 TGAGTCTGAAGAATTCAGAGAGG - Intronic
944081934 2:195797712-195797734 GGAGCCTGAAGAATTTATTTGGG - Intronic
946939533 2:224756583-224756605 TGAGCCTGAATAATTAAGTAAGG - Intergenic
1169231593 20:3892862-3892884 GGATTCTGATGCAGTAAGTCTGG - Intronic
1174030301 20:47618685-47618707 GGACTCTGAAGGAGTAAGTTTGG + Intronic
1174275493 20:49400802-49400824 AGAGACAGAAAAATTAAGTCAGG - Intronic
1174959885 20:55144099-55144121 GGAGTGTGAAGAATAAACTTTGG - Intergenic
1177002363 21:15629953-15629975 GAAGTCTTAAGTATTAAGTTAGG - Intergenic
1177986060 21:27976429-27976451 GGACTTTTAAGAATTAAGTCTGG + Intergenic
952321768 3:32284355-32284377 GGAGTCTTGAGAGTTAAGTCGGG + Intronic
953613343 3:44466716-44466738 GGATTCTGATTAATTAACTCTGG + Intronic
957137170 3:76304055-76304077 TGTGGCTGAAGAATTAACTCTGG - Intronic
957173030 3:76764551-76764573 TGAGCCTGGAAAATTAAGTCAGG - Intronic
957206353 3:77204151-77204173 GGATACTGAAGAATTAAACCAGG - Intronic
958586907 3:96098927-96098949 GGAGTCTGATGTTTGAAGTCAGG - Intergenic
960965610 3:123102316-123102338 GGTGTCCTAAGAAATAAGTCAGG - Intronic
962020303 3:131492929-131492951 CGAGTCTTAAGAATTAAGGTGGG - Intronic
962446520 3:135470832-135470854 GGATTCTGATGTAGTAAGTCTGG + Intergenic
962927492 3:140008386-140008408 GCAGGCTGAAGAAGTAAGGCAGG - Intronic
964198054 3:154087459-154087481 AGAGTTAGAAGCATTAAGTCTGG + Intergenic
966012069 3:175090989-175091011 TTATACTGAAGAATTAAGTCAGG + Intronic
970690736 4:18617621-18617643 GAAGTCGGAAGAATGAAGTATGG + Intergenic
974420467 4:61665817-61665839 TGACTCTGATGTATTAAGTCAGG - Intronic
975774945 4:77776242-77776264 GGAATCTGAAGCATTTAATCTGG - Intronic
976165487 4:82250484-82250506 GGAGTCTGAAGACTTGCTTCAGG - Intergenic
978081174 4:104593370-104593392 GGAGACTGAAGAATCAGGGCTGG + Intergenic
978963402 4:114711844-114711866 GGAGTGTGGAGAAGTAAGTCGGG - Intergenic
981651762 4:147068194-147068216 GGAGTCTGGAGACTTAAGATTGG - Intergenic
982277843 4:153655315-153655337 GGAGTCTGAAATATGAAATCTGG - Intergenic
982429748 4:155309373-155309395 GAAGACTCAAGAATTATGTCAGG + Intergenic
992950639 5:81853797-81853819 GGAGTCTGAATAAATAATTAAGG - Intergenic
993707163 5:91184022-91184044 GGAATCTGAAGGATTCAGACGGG + Intergenic
997346489 5:133196137-133196159 GGAGACTGAAGAAATAAGCCTGG + Intergenic
997868885 5:137489502-137489524 GGAGTAGGAAGGATTAAGTGGGG + Intronic
998460490 5:142306349-142306371 TGAGGCAGAAGAATTGAGTCTGG + Intergenic
998588102 5:143449468-143449490 TGAGTGTGAAGACTTAGGTCTGG - Intergenic
998955710 5:147436064-147436086 GGAGAGTGAACAATGAAGTCGGG - Intronic
1000537344 5:162495085-162495107 CAAGTATGAAAAATTAAGTCTGG - Intergenic
1000652751 5:163837407-163837429 GGAGTCTGAAAAATGGAGCCAGG - Intergenic
1001051958 5:168420841-168420863 GGAGGCTGAAGACTGAAGGCGGG - Intronic
1002203704 5:177547922-177547944 AGAGTCTGAAGGATGAAGGCAGG + Intronic
1003663472 6:8087220-8087242 GGAGTCAGATGAATTAAGACAGG + Intronic
1007277872 6:40688968-40688990 GAAGCATGAAGAATTAAGGCTGG - Intergenic
1007693312 6:43716517-43716539 GGAGTCTGGGGAATTAAGCTTGG + Intergenic
1007848648 6:44782127-44782149 GGAGCCTGAAACATTAAGCCAGG - Intergenic
1007907269 6:45474571-45474593 AGAGTCTGTAGAGTTTAGTCTGG + Intronic
1008842659 6:55922209-55922231 AGTCTCTGAAGAAATAAGTCAGG + Intergenic
1013274749 6:108573385-108573407 GGAGTCAGAAGGATTAAGGTGGG - Intronic
1013826905 6:114223449-114223471 GGAGTCTGCAAAATGAAGGCAGG + Intronic
1015134981 6:129858665-129858687 GGGGGCTGAAGAATTAAATGTGG - Intronic
1016913078 6:149217932-149217954 GGAGTCTGAAATGTTAAGTATGG + Intergenic
1016979059 6:149837645-149837667 GGAGTCTGAAGAATTAAGTCGGG - Intronic
1020005051 7:4778505-4778527 GGAGTCTGGAGAAGGAAGGCGGG + Intronic
1020614055 7:10436852-10436874 GGAGTCTGTAGTATTAAGGGAGG - Intergenic
1021249518 7:18306804-18306826 GGAGTGTGAGTAAATAAGTCTGG - Intronic
1021290515 7:18838045-18838067 GGAGTCTTATGAATTAAATCTGG - Intronic
1022191394 7:28019745-28019767 GGAGTCTTAAGAATCCATTCAGG - Intronic
1024431283 7:49290866-49290888 GGAGTCTGATGAATAGAGACAGG - Intergenic
1026289102 7:68989945-68989967 TAAGTCTGAGGAATAAAGTCAGG + Intergenic
1031067938 7:117127253-117127275 AGAATATGAAGATTTAAGTCAGG - Intronic
1031131059 7:117833639-117833661 GGAATATGAAGAATTCAGTGAGG - Intronic
1031729152 7:125276690-125276712 GGAGTCTGATGTATAAGGTCAGG + Intergenic
1035145704 7:156813217-156813239 GGAGTATGAAAAATTAGGCCAGG - Intronic
1040684753 8:49858474-49858496 TGAGGCTGCAGAACTAAGTCTGG - Intergenic
1042422094 8:68603049-68603071 GGAACCTGAAGAATTAAGGGTGG - Intronic
1048789060 8:138083679-138083701 GGAGTGTGAAGAATAAAACCAGG - Intergenic
1059649262 9:116300033-116300055 GGTTTCTGAAGAGTAAAGTCTGG + Intronic
1188768785 X:34128052-34128074 GAAGTCTGAATAAATAAGTATGG + Intergenic
1189527135 X:41834897-41834919 TGAGTCTGAAGAATTAGATGGGG - Intronic
1190836309 X:54104177-54104199 GGATACTGAAGAACTCAGTCAGG - Intronic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1192868267 X:75159529-75159551 GGATTTTGAATATTTAAGTCTGG - Intergenic
1195108386 X:101622610-101622632 GGAGGCTGAAGAATGATGTTGGG - Intergenic
1199675605 X:150186688-150186710 GAAGGCTGAAGAAGTAAGTGGGG + Intergenic