ID: 1016979090

View in Genome Browser
Species Human (GRCh38)
Location 6:149837828-149837850
Sequence CTGGCTGTCGATTGCTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016979084_1016979090 25 Left 1016979084 6:149837780-149837802 CCCTCTTCATTCATTCATTCATA 0: 2
1: 7
2: 94
3: 429
4: 1440
Right 1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 102
1016979085_1016979090 24 Left 1016979085 6:149837781-149837803 CCTCTTCATTCATTCATTCATAG 0: 1
1: 0
2: 40
3: 316
4: 1022
Right 1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 102
1016979087_1016979090 -2 Left 1016979087 6:149837807-149837829 CCATTGTTGGAACCTCTTCTTCT 0: 1
1: 0
2: 0
3: 30
4: 274
Right 1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016979090 Original CRISPR CTGGCTGTCGATTGCTCTGC AGG Intronic
900004580 1:36250-36272 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
900024302 1:206766-206788 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
900447151 1:2687006-2687028 CAGGCTGTCGAATGCTCACCTGG - Intronic
900448648 1:2694432-2694454 CAGGCTGTCGAATGCTCACCTGG - Intronic
900449511 1:2698690-2698712 CAGGCTGTCGAATGCTCACCTGG - Intronic
900452117 1:2755384-2755406 CAGGCTGTCGAATGCTCACCTGG - Intronic
900452979 1:2759641-2759663 CAGGCTGTCGAATGCTCACCTGG - Intronic
900454141 1:2765638-2765660 CAGGCTGTCGAATGCTCACCTGG - Intronic
900455588 1:2772900-2772922 CAGGCTGTCGAATGCTCACCTGG - Intronic
900730241 1:4253969-4253991 CTGCCTGTCTATTGCTCTTTGGG - Intergenic
901651375 1:10745025-10745047 CTGGGCTTTGATTGCTCTGCTGG - Intronic
902416985 1:16245648-16245670 CTGGCTGGGGAGTGCTGTGCTGG + Intergenic
903851425 1:26308841-26308863 CTGGCTGTAGATTCCGCAGCAGG + Intronic
906245841 1:44273467-44273489 CTGGATGCCTATTCCTCTGCTGG - Intronic
920443782 1:206000563-206000585 GTGGCTGTGGCTTCCTCTGCAGG + Intronic
920974738 1:210775203-210775225 CTGTTTGTTGTTTGCTCTGCGGG - Intronic
922560848 1:226568618-226568640 CTGGCTGTTCTTTGCTCAGCAGG - Intronic
922954189 1:229585557-229585579 GTGGTTGTGGAATGCTCTGCAGG - Intergenic
923266370 1:232318488-232318510 CTGGCTGCCCATTGCTCTCCAGG + Intergenic
1067672231 10:48333764-48333786 CAGGCTGTGGATGCCTCTGCGGG + Intronic
1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG + Intergenic
1070694585 10:78552459-78552481 CTTGCTGTAGACTGCTCTGCAGG + Intergenic
1071421999 10:85510176-85510198 CTGCCAGTAGATTGCTCTTCCGG - Intergenic
1083884746 11:65567140-65567162 ATGGCTGTCCTTTGCTCTGGAGG + Intergenic
1085842491 11:80028881-80028903 TTGCCTGTCGAGTGTTCTGCAGG + Intergenic
1089687086 11:120159460-120159482 CTGGCTGTCTTTTTTTCTGCTGG + Intronic
1091377999 12:38302-38324 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
1092408097 12:8234749-8234771 GTGTCTGCCGATTGGTCTGCTGG + Intergenic
1093652891 12:21664133-21664155 CTGGATGTGTATTGCTTTGCAGG - Intronic
1103926966 12:124428599-124428621 CTGGCTGCAGAGTGCTCTGTTGG - Intronic
1103941358 12:124503016-124503038 CAGCCTGTCGTTGGCTCTGCCGG + Intronic
1105587497 13:21758599-21758621 CTCGCTGTCTATTGCTCTTTCGG + Intergenic
1108093127 13:46871738-46871760 CTGGCTGAGTATGGCTCTGCGGG + Intronic
1114500577 14:23165408-23165430 GAGGCTGTGGATTGCTGTGCTGG - Exonic
1119183285 14:72618694-72618716 CTGGCTGTGGATGCCACTGCTGG + Intergenic
1119658017 14:76431465-76431487 TTGGCTGGACATTGCTCTGCTGG - Intronic
1122130720 14:99603411-99603433 CTGGCTGTCGATGGAGCTGCGGG + Exonic
1122402737 14:101476795-101476817 CTGCCTGTTCATTGCTTTGCTGG + Intergenic
1122540944 14:102497372-102497394 CTGGCTTTCGGTGGCTTTGCTGG + Intronic
1125078917 15:35653879-35653901 CTGGATGGCCATTGCTTTGCTGG + Intergenic
1132415057 15:101613683-101613705 CTCGCTGTCACGTGCTCTGCTGG - Intergenic
1132448928 15:101954694-101954716 CTGGCTGTGGGTGGCTCTGAGGG - Intergenic
1133788260 16:8989524-8989546 CTGGCTGTCGCTTGTTGGGCGGG + Intergenic
1135094790 16:19555908-19555930 CTGGCTTCAGATTGCTCCGCTGG - Intronic
1148483254 17:47974348-47974370 GTGGCTGTCGAGTGCTTTTCTGG + Intronic
1151715973 17:75831242-75831264 CAGGCTGAAGATTGCCCTGCAGG - Exonic
1155515381 18:26619580-26619602 CTGGCTGTCGACAGCTATTCAGG + Intronic
1155937330 18:31767467-31767489 CTAGCTGTCTATTGCTATGCTGG + Intergenic
1157069230 18:44386517-44386539 CTGTCTCTCCAATGCTCTGCTGG - Intergenic
1160127705 18:76193210-76193232 CTGTCAGTGGATTTCTCTGCAGG - Intergenic
1160636332 19:77859-77881 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
1164792250 19:30997133-30997155 CTGCCTGTGGCCTGCTCTGCAGG + Intergenic
926369611 2:12166740-12166762 CTGTCTGTTGATTGCTCTAGGGG - Intergenic
926423867 2:12723889-12723911 CTGGCTGCTGAGTGTTCTGCGGG - Intronic
927627448 2:24736956-24736978 CTGGCTGTCACTTTGTCTGCCGG - Intronic
932134167 2:69213991-69214013 CTGGCTGTGGGTTGCCCTGGGGG - Intronic
934861214 2:97764855-97764877 CTGGCTGTCACCTGCTCTCCCGG + Intronic
936565149 2:113577191-113577213 CTGGCTGTGGGTGGCTCTGAGGG - Intergenic
937910918 2:127075309-127075331 CAGGCTGTGGGTTGCTCTGAAGG - Intronic
938291682 2:130153995-130154017 CTGGCTGTGCATTGCTCTTGGGG - Intronic
938464869 2:131518968-131518990 CTGGCTGTGCATTGCTCTTGGGG + Intergenic
942338287 2:174915080-174915102 CTGGCTGCCGCTGGCTCTCCCGG + Exonic
949001577 2:241617495-241617517 CTGGCTCTTAATGGCTCTGCAGG + Intronic
1170233399 20:14075015-14075037 CTGTCTGTGTATTGCACTGCCGG + Intronic
1178788541 21:35676645-35676667 CTGGCTGCCCTTTGTTCTGCTGG + Intronic
1184307409 22:43615281-43615303 CTGGCTGTCATTGGCCCTGCTGG + Intronic
950443228 3:13021981-13022003 CTGGCTGTCGACTGTTGGGCCGG - Intronic
951625270 3:24654171-24654193 CTGGCTGTCCAGTGCACTGTAGG - Intergenic
954249812 3:49358722-49358744 CTGGCTGTCCCCTGCACTGCCGG - Intergenic
954522733 3:51243393-51243415 CTGGCCCTCGATGGCTCTGGAGG - Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
956287640 3:67627551-67627573 CTAGGTGTTCATTGCTCTGCGGG + Intronic
956738674 3:72258475-72258497 CTGGCTGGCGATGGAGCTGCTGG - Intergenic
961887026 3:130103237-130103259 GTGTCTGCCGATTGGTCTGCTGG + Intronic
963304416 3:143635190-143635212 CTGGCTGTCGCTCCCTCTCCAGG + Intronic
965076586 3:163986982-163987004 CCGGCTGTAGATTCCTCTGGTGG - Intergenic
968818111 4:2832152-2832174 CTGGCTGGCCAGGGCTCTGCTGG + Intronic
983512913 4:168628349-168628371 ATGGCTGTCTGTTGCTCTGAGGG + Intronic
985879650 5:2628610-2628632 CTGGCAGTGAGTTGCTCTGCTGG + Intergenic
990346159 5:54873730-54873752 TTGTCTGTGGATTGCTCTCCAGG - Intergenic
1001575108 5:172758170-172758192 GTGGCTGTTGAGAGCTCTGCGGG + Intergenic
1001917743 5:175575746-175575768 CTGGCTCTCAGTAGCTCTGCTGG - Intergenic
1003393805 6:5736028-5736050 CTGGCTGTCGATTTCTCACGGGG + Intronic
1007978697 6:46128673-46128695 CTGGCCCATGATTGCTCTGCTGG + Intergenic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1018846570 6:167561002-167561024 CTGGCTGTGGTTTGCACAGCTGG - Intergenic
1021575152 7:22099753-22099775 CTGGCTGTCATTTTCTCTGTAGG + Intergenic
1026734498 7:72941075-72941097 GTCGCTGGAGATTGCTCTGCAGG + Intronic
1026784832 7:73295983-73296005 GTCGCTGGAGATTGCTCTGCAGG + Intergenic
1027109244 7:75423945-75423967 GTCGCTGGAGATTGCTCTGCAGG - Intronic
1033474174 7:141674830-141674852 CTGGCTGTGGCTGGCCCTGCTGG + Intronic
1034540869 7:151757089-151757111 CTGCCTGGCGTTTGTTCTGCGGG + Intronic
1036070301 8:5435234-5435256 CTGGCAAACGATTTCTCTGCAGG + Intergenic
1036848507 8:12185848-12185870 GTGTCTGCCGATTGGTCTGCTGG + Intronic
1036869867 8:12428129-12428151 GTGTCTGCCGATTGGTCTGCTGG + Intronic
1047860130 8:128956698-128956720 CTCTCAGTCTATTGCTCTGCAGG + Intergenic
1049135176 8:140891627-140891649 CTTGCTGCCGAAAGCTCTGCTGG - Intronic
1049887275 9:36033-36055 CTGGCTGTGGGTGGCTCTGAGGG + Intergenic
1050279089 9:4032082-4032104 CTTGGTGTCCCTTGCTCTGCAGG - Intronic
1050332467 9:4559395-4559417 CTGGCTGTTGATTGCTCCTTTGG - Intronic
1052477944 9:28985299-28985321 TTGGCTGTCAATAGCGCTGCAGG + Intergenic
1052489071 9:29139916-29139938 CTGTCTGTCTATGGCTCTGCAGG - Intergenic
1056931538 9:90881905-90881927 CTGCCTGACGACTGCTCCGCAGG + Intronic
1058130823 9:101250907-101250929 CTGACTGTTGCTTTCTCTGCAGG + Intronic
1058683484 9:107460388-107460410 CTGGCTGTAGATATCTGTGCTGG - Intergenic
1059256078 9:112932117-112932139 CTGACTCCAGATTGCTCTGCAGG + Intergenic
1061429060 9:130519639-130519661 CCGGCTGTGGAGGGCTCTGCAGG + Intergenic
1187260579 X:17682023-17682045 CTGGCTTTGGGCTGCTCTGCAGG + Intronic