ID: 1016980165

View in Genome Browser
Species Human (GRCh38)
Location 6:149846503-149846525
Sequence ACGCCTCCACTCACATACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016980165_1016980174 28 Left 1016980165 6:149846503-149846525 CCATGGTATGTGAGTGGAGGCGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1016980174 6:149846554-149846576 TTTAGAAGGTTGGTGTGACGGGG No data
1016980165_1016980170 14 Left 1016980165 6:149846503-149846525 CCATGGTATGTGAGTGGAGGCGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1016980170 6:149846540-149846562 ATTCGGAGCAGAGATTTAGAAGG 0: 1
1: 0
2: 0
3: 12
4: 142
1016980165_1016980173 27 Left 1016980165 6:149846503-149846525 CCATGGTATGTGAGTGGAGGCGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1016980173 6:149846553-149846575 ATTTAGAAGGTTGGTGTGACGGG 0: 1
1: 0
2: 0
3: 10
4: 185
1016980165_1016980169 -3 Left 1016980165 6:149846503-149846525 CCATGGTATGTGAGTGGAGGCGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1016980169 6:149846523-149846545 CGTGGGCTGCAGGATTGATTCGG 0: 1
1: 0
2: 4
3: 5
4: 99
1016980165_1016980171 18 Left 1016980165 6:149846503-149846525 CCATGGTATGTGAGTGGAGGCGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1016980171 6:149846544-149846566 GGAGCAGAGATTTAGAAGGTTGG No data
1016980165_1016980172 26 Left 1016980165 6:149846503-149846525 CCATGGTATGTGAGTGGAGGCGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1016980172 6:149846552-149846574 GATTTAGAAGGTTGGTGTGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016980165 Original CRISPR ACGCCTCCACTCACATACCA TGG (reversed) Intronic
905332771 1:37218494-37218516 TGGCCTCCACTAACATAACAAGG - Intergenic
911677354 1:100674654-100674676 ACACTTCCTCTCACATTCCATGG - Intergenic
920358188 1:205391681-205391703 CCGCCTCCACGCACACCCCAAGG + Intronic
1064791013 10:18958130-18958152 AGGGCTCCACCCACATCCCACGG - Intergenic
1065539746 10:26750999-26751021 GCTCCTCCACTTACATACAATGG + Intronic
1072022161 10:91412850-91412872 CCCCCTCCCCACACATACCAAGG - Intronic
1073073191 10:100807649-100807671 ATGCCTCCACCCACATACGCTGG + Intronic
1079386001 11:19980251-19980273 CCGCCTCCACCCACCTATCATGG + Intronic
1089067638 11:115674166-115674188 ACGCCTCCCCTCACATCACGTGG + Intergenic
1090727209 11:129538934-129538956 AGGTCTCCACTCAGCTACCATGG + Intergenic
1097843834 12:64346441-64346463 ACACCTTCACACACATACCCAGG + Intronic
1098211634 12:68172349-68172371 TCACTTCCACTCACATTCCATGG - Intergenic
1102413264 12:112738616-112738638 ACACCACCACTCACCTTCCAGGG - Intronic
1102738649 12:115186241-115186263 GCGACTCTACTCAGATACCAAGG + Intergenic
1104465827 12:128989577-128989599 CCACCTCCACTTACATCCCATGG + Intergenic
1104972156 12:132535839-132535861 ACACGTGCACTCACACACCATGG - Intronic
1104972160 12:132535888-132535910 ACACGTGCACTCACACACCATGG - Intronic
1124955358 15:34356661-34356683 ACCCTTCCACCCACATGCCAAGG + Exonic
1126214251 15:46136177-46136199 AGACCTACACGCACATACCAAGG - Intergenic
1129626954 15:77211416-77211438 ACGGCTCCACTAAGATACCATGG + Intronic
1142625021 17:1186527-1186549 ACGCCCCCACACACTTCCCAGGG + Intronic
1143491179 17:7285991-7286013 ACTCCTCCAGCCACAGACCATGG + Intronic
1144125037 17:12195383-12195405 ACACCTACACACACATACCTAGG - Intergenic
1146127226 17:30238851-30238873 ACGCCTGCATTCACATTCTAAGG - Intergenic
1146737945 17:35255436-35255458 ACGCATACACACACATATCATGG - Intronic
1152432216 17:80254816-80254838 TGGCTTGCACTCACATACCAAGG + Intergenic
1152568866 17:81112500-81112522 GCCCCTCCACTCTCATTCCAAGG - Intronic
1156594618 18:38533374-38533396 AGGCCTCTTCTCACATACCCAGG + Intergenic
1157393458 18:47322396-47322418 ACACATGCACTCACATGCCAAGG - Intergenic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1162748979 19:12816648-12816670 AGGCCTCCTCTCACATAGGAAGG - Intronic
1164539378 19:29111613-29111635 AAACCTCCACTCACATGCCCAGG + Intergenic
1165611372 19:37156193-37156215 AGGCCTCCTTTCAGATACCAAGG + Intronic
1165614752 19:37189988-37190010 AGGCCTCCTTTCAGATACCAAGG + Intronic
1167101027 19:47404414-47404436 AGGCCTCCACTCTCATCCCCAGG + Intronic
1167204670 19:48092954-48092976 ATCCCTCCCCTCACACACCAGGG - Intronic
928012562 2:27623794-27623816 ATCACTCCACTCACATTCCATGG - Intergenic
937553305 2:123122280-123122302 ACGCATACACACACACACCATGG + Intergenic
946150543 2:217764357-217764379 ACCCCACCACACACACACCATGG - Intergenic
1170200466 20:13738068-13738090 ACACATTCACTCACATAACAGGG + Intronic
1171448118 20:25218779-25218801 ACCCCTCCACTCGCATGCCCTGG - Intronic
1175937954 20:62523555-62523577 ACGCCTGCACTCACACTCCCAGG - Intergenic
1185385351 22:50529337-50529359 ACGCGTACCCCCACATACCAGGG - Exonic
954645703 3:52130380-52130402 GCTCCTGCACTCACTTACCAGGG + Intronic
958852377 3:99344424-99344446 ACTCCTCCATTCCCATACTAAGG + Intergenic
967277262 3:187788577-187788599 TTGCTTCCACTCACATCCCATGG + Intergenic
967394556 3:188992429-188992451 ATGCTTCCACTCACATTTCATGG + Intronic
968573399 4:1353986-1354008 CAGCCTCCACTCACACCCCAGGG - Intronic
968919270 4:3514368-3514390 CCTCCTCCCCTCACATCCCAGGG + Intronic
970592827 4:17574510-17574532 GACCCTCTACTCACATACCAAGG + Intergenic
971837027 4:31780586-31780608 ACTCATCCATTCACATACTATGG + Intergenic
972167417 4:36304592-36304614 TGGTCTCCATTCACATACCATGG + Intronic
981348180 4:143699611-143699633 ACGCCCCCACTCACCCACCAGGG - Exonic
985734888 5:1573768-1573790 ACGCCTCCCCTCTCCTCCCACGG - Intergenic
995169562 5:109091447-109091469 ATGCCTCCACCCAGATTCCACGG + Intronic
1002254536 5:177949597-177949619 AAGCGTCCACTCACGTGCCATGG + Intergenic
1002483454 5:179518215-179518237 AAGCGTCCACTCACGTGCCATGG - Intergenic
1004012786 6:11705152-11705174 GCACCTCCACTCACCAACCAGGG + Intergenic
1008058692 6:46973978-46974000 ATGCCTGCACTCACTAACCAAGG + Intergenic
1012729148 6:102858215-102858237 ACACATACACACACATACCATGG - Intergenic
1013512753 6:110859254-110859276 ACACCGCCACTCACAGACCCTGG - Intronic
1014207781 6:118675106-118675128 ACACATGCACTCACATACAAGGG + Intronic
1015643321 6:135362099-135362121 ACACCTACACACACACACCATGG - Intronic
1016980165 6:149846503-149846525 ACGCCTCCACTCACATACCATGG - Intronic
1023189963 7:37569939-37569961 TCGCCACCACTCACATACTTTGG - Intergenic
1024145470 7:46512193-46512215 CCAGCTCCACTCACATACCATGG - Intergenic
1026183589 7:68063439-68063461 ACGCCTGCACTCACACACACAGG - Intergenic
1026786254 7:73303582-73303604 ACGCCCCCACTCACTCACCTTGG + Exonic
1034392154 7:150795055-150795077 ACCCCTTCACTCCCATGCCATGG + Intronic
1034967281 7:155399125-155399147 AGGCCTCCACTCACCACCCAGGG + Intergenic
1035596395 8:861363-861385 ACCCCTCCTCACACATACCGGGG + Intergenic
1048374917 8:133814835-133814857 AAGCTTCCACTTACATTCCACGG + Intergenic
1049647236 8:143740895-143740917 GCTCCACCACTGACATACCACGG - Intergenic
1049815934 8:144600150-144600172 ACGCCTCCACGCACACACACAGG - Intronic
1049816013 8:144601001-144601023 ACGCCTCCACGCACACACACAGG - Intronic
1049816038 8:144601307-144601329 ACGCCTCCACACACACACACAGG - Intronic
1049816065 8:144601724-144601746 ACGCCTCCACGCACACACACAGG - Intronic
1049816071 8:144601800-144601822 ACGCCTCCACACACACACACAGG - Intronic
1049816107 8:144602266-144602288 ACGCCTCCACGCACACACACAGG - Intronic
1049816116 8:144602384-144602406 ACGCCTCCACGCACACACACAGG - Intronic
1049816172 8:144603180-144603202 ACGCCTCCACGCACACACACAGG - Intronic
1052016520 9:23474681-23474703 AGGCCTCCACACACATATTAAGG - Intergenic
1053004020 9:34592549-34592571 ACCCCCCCACACACACACCAAGG + Intergenic
1059451028 9:114371617-114371639 GCCCCTCCACACACACACCAAGG - Intronic
1060326925 9:122625812-122625834 GCCCCTCCACCCACATCCCAAGG - Intergenic
1060887884 9:127168375-127168397 GCACCTCCACTCAGATATCAGGG - Intronic
1061880680 9:133567432-133567454 AGGCCTCCACCCACATCCAAGGG - Intronic
1062143309 9:134972252-134972274 ACCCCTCCACTCACCTAAGAAGG + Intergenic
1186025421 X:5305722-5305744 AAGCTTCCACTATCATACCATGG + Intergenic
1187037014 X:15550927-15550949 ATGTCTCCACTCACATACTTAGG - Intronic
1187127405 X:16467007-16467029 ACCCTTCCACTCACAGGCCATGG + Intergenic
1188518192 X:31010120-31010142 ATGCCACCTCTCACATACTATGG - Intergenic
1189284000 X:39839105-39839127 AACCCTCCACTCTCACACCAAGG - Intergenic
1189846977 X:45147205-45147227 ACGCCTCGAATCAAATTCCAGGG + Intergenic
1195394506 X:104396845-104396867 AGGCCTCCACTGCCATACTAAGG - Intergenic
1200116632 X:153772420-153772442 CCACCTCCACTCACATGCCATGG - Intronic