ID: 1016986649

View in Genome Browser
Species Human (GRCh38)
Location 6:149900468-149900490
Sequence CTGGGAGGCACCGGCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016986649_1016986661 28 Left 1016986649 6:149900468-149900490 CCTTCACAGCCGGTGCCTCCCAG No data
Right 1016986661 6:149900519-149900541 GAGATGTGGTGGGCAGCATCAGG No data
1016986649_1016986659 17 Left 1016986649 6:149900468-149900490 CCTTCACAGCCGGTGCCTCCCAG No data
Right 1016986659 6:149900508-149900530 CAGCAGCAAAAGAGATGTGGTGG No data
1016986649_1016986660 18 Left 1016986649 6:149900468-149900490 CCTTCACAGCCGGTGCCTCCCAG No data
Right 1016986660 6:149900509-149900531 AGCAGCAAAAGAGATGTGGTGGG No data
1016986649_1016986658 14 Left 1016986649 6:149900468-149900490 CCTTCACAGCCGGTGCCTCCCAG No data
Right 1016986658 6:149900505-149900527 CAGCAGCAGCAAAAGAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016986649 Original CRISPR CTGGGAGGCACCGGCTGTGA AGG (reversed) Intergenic
No off target data available for this crispr