ID: 1016986710

View in Genome Browser
Species Human (GRCh38)
Location 6:149900814-149900836
Sequence CAGCAAAAGGAGAAGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016986710_1016986715 21 Left 1016986710 6:149900814-149900836 CCAGACTGCTTCTCCTTTTGCTG No data
Right 1016986715 6:149900858-149900880 ATTCTAATATTCGCCAGGCTTGG No data
1016986710_1016986714 16 Left 1016986710 6:149900814-149900836 CCAGACTGCTTCTCCTTTTGCTG No data
Right 1016986714 6:149900853-149900875 CAGAAATTCTAATATTCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016986710 Original CRISPR CAGCAAAAGGAGAAGCAGTC TGG (reversed) Intergenic
No off target data available for this crispr