ID: 1016987203

View in Genome Browser
Species Human (GRCh38)
Location 6:149904558-149904580
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 2, 2: 2, 3: 35, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016987203_1016987213 25 Left 1016987203 6:149904558-149904580 CCCCACATGGACACCTTCCTGCA 0: 1
1: 2
2: 2
3: 35
4: 241
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987203_1016987210 12 Left 1016987203 6:149904558-149904580 CCCCACATGGACACCTTCCTGCA 0: 1
1: 2
2: 2
3: 35
4: 241
Right 1016987210 6:149904593-149904615 CCCCATCTGAAAGAGCTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016987203 Original CRISPR TGCAGGAAGGTGTCCATGTG GGG (reversed) Intergenic