ID: 1016987205 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:149904560-149904582 |
| Sequence | CTTGCAGGAAGGTGTCCATG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 221 | |||
| Summary | {0: 1, 1: 1, 2: 3, 3: 12, 4: 204} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1016987205_1016987210 | 10 | Left | 1016987205 | 6:149904560-149904582 | CCACATGGACACCTTCCTGCAAG | 0: 1 1: 1 2: 3 3: 12 4: 204 |
||
| Right | 1016987210 | 6:149904593-149904615 | CCCCATCTGAAAGAGCTTAAAGG | 0: 1 1: 0 2: 0 3: 8 4: 126 |
||||
| 1016987205_1016987213 | 23 | Left | 1016987205 | 6:149904560-149904582 | CCACATGGACACCTTCCTGCAAG | 0: 1 1: 1 2: 3 3: 12 4: 204 |
||
| Right | 1016987213 | 6:149904606-149904628 | AGCTTAAAGGAAAGCTTGCATGG | 0: 1 1: 0 2: 5 3: 13 4: 185 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1016987205 | Original CRISPR | CTTGCAGGAAGGTGTCCATG TGG (reversed) | Intergenic | ||