ID: 1016987205

View in Genome Browser
Species Human (GRCh38)
Location 6:149904560-149904582
Sequence CTTGCAGGAAGGTGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 3, 3: 12, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016987205_1016987213 23 Left 1016987205 6:149904560-149904582 CCACATGGACACCTTCCTGCAAG 0: 1
1: 1
2: 3
3: 12
4: 204
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987205_1016987210 10 Left 1016987205 6:149904560-149904582 CCACATGGACACCTTCCTGCAAG 0: 1
1: 1
2: 3
3: 12
4: 204
Right 1016987210 6:149904593-149904615 CCCCATCTGAAAGAGCTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016987205 Original CRISPR CTTGCAGGAAGGTGTCCATG TGG (reversed) Intergenic