ID: 1016987208

View in Genome Browser
Species Human (GRCh38)
Location 6:149904575-149904597
Sequence TGGGGCCGAAATGCACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016987208_1016987210 -5 Left 1016987208 6:149904575-149904597 CCTGCAAGTGCATTTCGGCCCCA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1016987210 6:149904593-149904615 CCCCATCTGAAAGAGCTTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 126
1016987208_1016987213 8 Left 1016987208 6:149904575-149904597 CCTGCAAGTGCATTTCGGCCCCA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987208_1016987214 19 Left 1016987208 6:149904575-149904597 CCTGCAAGTGCATTTCGGCCCCA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1016987214 6:149904617-149904639 AAGCTTGCATGGCTTTTCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016987208 Original CRISPR TGGGGCCGAAATGCACTTGC AGG (reversed) Intergenic