ID: 1016987213

View in Genome Browser
Species Human (GRCh38)
Location 6:149904606-149904628
Sequence AGCTTAAAGGAAAGCTTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 185}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016987207_1016987213 12 Left 1016987207 6:149904571-149904593 CCTTCCTGCAAGTGCATTTCGGC 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987205_1016987213 23 Left 1016987205 6:149904560-149904582 CCACATGGACACCTTCCTGCAAG 0: 1
1: 1
2: 3
3: 12
4: 204
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987203_1016987213 25 Left 1016987203 6:149904558-149904580 CCCCACATGGACACCTTCCTGCA 0: 1
1: 2
2: 2
3: 35
4: 241
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987209_1016987213 -10 Left 1016987209 6:149904593-149904615 CCCCATCTGAAAGAGCTTAAAGG 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987208_1016987213 8 Left 1016987208 6:149904575-149904597 CCTGCAAGTGCATTTCGGCCCCA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185
1016987204_1016987213 24 Left 1016987204 6:149904559-149904581 CCCACATGGACACCTTCCTGCAA 0: 1
1: 0
2: 2
3: 10
4: 191
Right 1016987213 6:149904606-149904628 AGCTTAAAGGAAAGCTTGCATGG 0: 1
1: 0
2: 5
3: 13
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016987213 Original CRISPR AGCTTAAAGGAAAGCTTGCA TGG Intergenic