ID: 1016987214

View in Genome Browser
Species Human (GRCh38)
Location 6:149904617-149904639
Sequence AAGCTTGCATGGCTTTTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016987209_1016987214 1 Left 1016987209 6:149904593-149904615 CCCCATCTGAAAGAGCTTAAAGG 0: 1
1: 0
2: 1
3: 19
4: 153
Right 1016987214 6:149904617-149904639 AAGCTTGCATGGCTTTTCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 157
1016987211_1016987214 0 Left 1016987211 6:149904594-149904616 CCCATCTGAAAGAGCTTAAAGGA 0: 1
1: 0
2: 1
3: 11
4: 220
Right 1016987214 6:149904617-149904639 AAGCTTGCATGGCTTTTCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 157
1016987207_1016987214 23 Left 1016987207 6:149904571-149904593 CCTTCCTGCAAGTGCATTTCGGC 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1016987214 6:149904617-149904639 AAGCTTGCATGGCTTTTCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 157
1016987208_1016987214 19 Left 1016987208 6:149904575-149904597 CCTGCAAGTGCATTTCGGCCCCA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1016987214 6:149904617-149904639 AAGCTTGCATGGCTTTTCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 157
1016987212_1016987214 -1 Left 1016987212 6:149904595-149904617 CCATCTGAAAGAGCTTAAAGGAA 0: 1
1: 0
2: 2
3: 21
4: 284
Right 1016987214 6:149904617-149904639 AAGCTTGCATGGCTTTTCCCCGG 0: 1
1: 0
2: 0
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016987214 Original CRISPR AAGCTTGCATGGCTTTTCCC CGG Intergenic