ID: 1016989029

View in Genome Browser
Species Human (GRCh38)
Location 6:149916753-149916775
Sequence CTCTCCCAGCCCCCTCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 2, 2: 9, 3: 72, 4: 624}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016989019_1016989029 14 Left 1016989019 6:149916716-149916738 CCCTGCGCCCCCTCCTTTTCAAT 0: 1
1: 0
2: 2
3: 7
4: 208
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624
1016989020_1016989029 13 Left 1016989020 6:149916717-149916739 CCTGCGCCCCCTCCTTTTCAATT 0: 1
1: 0
2: 2
3: 15
4: 178
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624
1016989022_1016989029 7 Left 1016989022 6:149916723-149916745 CCCCCTCCTTTTCAATTAGGTGT 0: 1
1: 0
2: 0
3: 17
4: 211
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624
1016989023_1016989029 6 Left 1016989023 6:149916724-149916746 CCCCTCCTTTTCAATTAGGTGTA 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624
1016989024_1016989029 5 Left 1016989024 6:149916725-149916747 CCCTCCTTTTCAATTAGGTGTAC 0: 3
1: 0
2: 0
3: 13
4: 187
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624
1016989026_1016989029 1 Left 1016989026 6:149916729-149916751 CCTTTTCAATTAGGTGTACCAAG 0: 3
1: 0
2: 0
3: 6
4: 116
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624
1016989025_1016989029 4 Left 1016989025 6:149916726-149916748 CCTCCTTTTCAATTAGGTGTACC 0: 3
1: 0
2: 0
3: 17
4: 96
Right 1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG 0: 1
1: 2
2: 9
3: 72
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016989029 Original CRISPR CTCTCCCAGCCCCCTCCTTC TGG Intergenic
900139890 1:1135186-1135208 CTCTCCCAGGCCCCTCCCTGGGG - Intergenic
900384091 1:2401424-2401446 CTCTCCCATCCCCAGCCTTGTGG + Intronic
900387550 1:2417441-2417463 CTCACCAGGCCCCCTCCCTCCGG - Intergenic
900596347 1:3481867-3481889 TGCTCCCAGCCCCCGCCTGCTGG + Intergenic
900609026 1:3536694-3536716 CTCTCCCAGCCCCCAGCGGCTGG + Intronic
900670074 1:3846779-3846801 CTCTCCCTGCCCCCTCCAAGAGG - Intronic
900759295 1:4460365-4460387 CTGTCCCAGCCTCATCCTTGAGG + Intergenic
900987263 1:6080371-6080393 CCCCCCCAGCCTCCTCCTCCCGG - Intronic
900996573 1:6126348-6126370 CTCTCCCGGCCCGCACCTCCCGG + Intronic
900996609 1:6126461-6126483 CTCTCCCGGCCCGCACCTCCCGG + Intronic
901004775 1:6166401-6166423 CTCTCCCAGCCCCTGCCTTGTGG - Intronic
901787569 1:11634857-11634879 CTCTCCCTCCTCCCTCCTCCTGG - Intergenic
901973220 1:12924684-12924706 CTCTTCCAGTTCCCTCCATCTGG - Intronic
902011957 1:13277079-13277101 CTCTTCCAGTTCCCTCCATCTGG + Intergenic
902199400 1:14822540-14822562 CTCTCTCAGCCCCTCCCTCCTGG + Intronic
903191602 1:21659539-21659561 CTCTCGCCGCCCCCTCCCGCGGG + Intronic
903319073 1:22530997-22531019 CTCTCTGAGCTCCCTCCTCCTGG + Exonic
903433405 1:23327063-23327085 CCCTCCTAGCCCCCACCTCCAGG + Intronic
903970676 1:27116960-27116982 CTCTGCCTGCCTCCTCCTTCAGG + Intronic
904211330 1:28888197-28888219 CTGTCCAAGCCTCCTCCTTCTGG - Intronic
904622242 1:31782439-31782461 CACTCCCAGCCCCCTTCCTGGGG + Intergenic
904717744 1:32481752-32481774 CTCTCCCACCTCCCACCCTCCGG + Intronic
905044296 1:34984220-34984242 CAAGCCCAGCCCCCTCCTCCTGG - Intronic
905159071 1:36015366-36015388 CTCTCCAAACCCCATCCTTTTGG + Intronic
905241239 1:36582966-36582988 CTCCCCCAGGCCCATCCTCCAGG + Intergenic
905253901 1:36667645-36667667 CTCACCCTGACCCCTTCTTCTGG + Intergenic
905345100 1:37306020-37306042 GCCTCCCAGCCCCCTCTCTCTGG + Intergenic
906146136 1:43561737-43561759 CTCTCCCATCCCCATCCCTGAGG - Intronic
906650546 1:47509389-47509411 CTCTCCCAGCTCCTCCCTTCAGG - Intergenic
906775448 1:48525329-48525351 TTCTACAAGACCCCTCCTTCAGG - Intergenic
907052008 1:51335982-51336004 CCCTCCCAGCCCCTTCCCCCAGG + Intronic
907445043 1:54502038-54502060 CTCTCTTAGCCACCTCCTCCGGG + Intergenic
907460807 1:54604298-54604320 CTACCCCACCCCCTTCCTTCAGG - Intronic
907976012 1:59432125-59432147 CTCTCCAAACCCCATCTTTCAGG - Intronic
910938151 1:92504108-92504130 CTCTCCCAGCTCCCTCGGCCCGG - Intergenic
912997638 1:114547253-114547275 CTCTGCTAGCAGCCTCCTTCTGG - Intergenic
913152678 1:116060891-116060913 CTCTGCCAGACTCCACCTTCTGG - Intronic
913671885 1:121104894-121104916 CTCTCCAAGCCCTGTCCTTTTGG + Intergenic
914662136 1:149800284-149800306 CTCTCCAAGCCCTGTCCTTTTGG + Intronic
914751433 1:150537669-150537691 CTCTCCCAGCCCAAACCCTCTGG - Intergenic
914869220 1:151459106-151459128 CTCTCCCCACCCCCTGCTCCCGG - Intronic
914869306 1:151459382-151459404 CCCCCCCACCCCCCTCCCTCGGG - Exonic
915283810 1:154840406-154840428 CTTTCCCAGCTCCCTGCTTCGGG - Intronic
915475426 1:156150161-156150183 CTCTGTCAGCCCCCTCTTTAGGG - Intronic
915555422 1:156658254-156658276 CTCACCCAGCCCCATCTTGCAGG - Exonic
915570385 1:156742260-156742282 CTCTCCCACCCTCTTCCTACTGG - Intronic
915936149 1:160091439-160091461 CCCTCCCAAGCCCCTCCCTCTGG - Exonic
916479841 1:165205233-165205255 CTCACCCAGCCCCCTACTCTGGG + Intronic
916582729 1:166123176-166123198 CTCTGGCAGCTGCCTCCTTCTGG + Intronic
916930030 1:169567237-169567259 CTATCCCTCCCCCCTCCTTTGGG - Intronic
917188799 1:172391323-172391345 CTCCCCCAGCCCCCTTCCCCGGG - Intronic
917481665 1:175417287-175417309 CTCCACCATCCCCCTCCATCTGG - Intronic
917855280 1:179094575-179094597 CTCACCCAGCCCCTTCAGTCGGG + Intronic
918037927 1:180893758-180893780 CCCTCCCCTCCCCTTCCTTCCGG + Intergenic
918042064 1:180919505-180919527 CTGCCCCAGCCCTCTCCTCCAGG - Intronic
918831315 1:189402283-189402305 CGCTCCCAGTCCTCTCCTTTTGG - Intergenic
919520790 1:198584271-198584293 CTCTGCCAGGCCGCTCCGTCTGG - Intergenic
919846493 1:201645981-201646003 CTCTTCCTACCCCATCCTTCAGG - Intronic
919879812 1:201894041-201894063 CTCTTCCAGCTCCCAGCTTCAGG - Intergenic
919896816 1:202014080-202014102 CACTCCCACCGCCCTCTTTCTGG + Intronic
920032134 1:203043918-203043940 CTCTCCCTGCCAGCTGCTTCTGG + Intronic
920259920 1:204682263-204682285 CCCTCCCTGCCTCCTCATTCAGG + Intronic
920387645 1:205580019-205580041 CTCTCCCAGCCTCCTCCCCCAGG + Intronic
920438915 1:205965555-205965577 CTCTCCCCTCTCCCTCCCTCTGG + Intergenic
920654766 1:207867369-207867391 CTCTCCCAGCCCCCCTCCTATGG + Intergenic
920660585 1:207911147-207911169 CTCTTCCCGCCCCCTCCGCCCGG + Exonic
920674864 1:208031759-208031781 CTCTCCCCCACCCCTCCTCCAGG - Exonic
920740136 1:208573782-208573804 ATCTCTGAGCCCCCTTCTTCTGG - Intergenic
920808972 1:209264429-209264451 CTCTCTCAGCCCTGTCCTTTTGG - Intergenic
921376240 1:214476587-214476609 CTCTGCCAGCTCTCTCCATCTGG + Intronic
921442850 1:215208350-215208372 TTCTCCCACCCTCCCCCTTCAGG - Intronic
921530532 1:216277220-216277242 CTCTCCCAGCCCCCTCCTCTGGG + Intronic
921731251 1:218581016-218581038 CTTTCCCATGCACCTCCTTCTGG + Intergenic
921933326 1:220773264-220773286 CTCTCCAAACCCCATCTTTCAGG - Intronic
922745222 1:228039465-228039487 CCCTCCCAACCCCCTTCTCCTGG + Intronic
923540383 1:234884487-234884509 CTCTGCCAGTCCCTTCATTCAGG - Intergenic
924365989 1:243294465-243294487 CTCTCCCCCCCCCCACCTTTTGG - Intronic
1062779664 10:190477-190499 CCTTCCCAGACTCCTCCTTCAGG + Intronic
1063595980 10:7435979-7436001 CTCCCCCACCCCCCTCCATCTGG - Intergenic
1064380392 10:14837125-14837147 CTATGCTAGCCCCTTCCTTCTGG - Intronic
1065000972 10:21337296-21337318 TCCTCCCAGCCCCCACCCTCCGG + Intergenic
1065246921 10:23767969-23767991 ACCAGCCAGCCCCCTCCTTCTGG - Intronic
1065390125 10:25174756-25174778 CTCTCCCTGCTCCCTCCTCGGGG - Intergenic
1066281121 10:33919275-33919297 TTCTCCCAGCCCAGTCCTTTGGG + Intergenic
1067428968 10:46229538-46229560 CTCTCCCTCCCCCCGCCTTGAGG - Intergenic
1067667130 10:48288262-48288284 CTCCCTCAGCCTCCTCCTTGTGG - Intergenic
1067815364 10:49471543-49471565 CTCTCCCTGCTCCCACCTGCAGG + Intronic
1069183818 10:65397017-65397039 CGCTCCCACACACCTCCTTCTGG - Intergenic
1069556635 10:69402631-69402653 CGCTCCCGGCCCACCCCTTCTGG + Intergenic
1069606699 10:69743400-69743422 GCCTCCCAGCCCTCTCCTGCAGG - Intergenic
1069695367 10:70382014-70382036 TTCTCCCAGTCCCCGCCTGCCGG - Intronic
1069777931 10:70937670-70937692 CACTCCCACCGCCCTCCCTCTGG - Intergenic
1069842800 10:71350411-71350433 TTCTCCCAGCCCCCTCCCACTGG + Intronic
1071022628 10:81076573-81076595 CTCTCCCACCCTCCACCCTCAGG + Intergenic
1071103646 10:82068682-82068704 CTTTCCCTGCCCGCTCCCTCTGG - Intronic
1072361561 10:94664292-94664314 TTCTCCCAGCCCCCCCATACTGG + Intergenic
1072732666 10:97858134-97858156 CTCTGCCTGCCCCCTGCTACTGG + Intronic
1073070244 10:100788626-100788648 TTCTGCCAGCCCCCTGCATCTGG - Intronic
1073124250 10:101140016-101140038 CCCCCCCAGCCCCCATCTTCAGG + Intergenic
1073490814 10:103852190-103852212 CTCTGCCAGGCCCCTGCTTGGGG - Intronic
1074061498 10:109970187-109970209 CTCTCCCTGCCCCCTCCTTCTGG + Intergenic
1074440747 10:113475483-113475505 CCCTCCCAGCCCTCTCCCTCTGG - Intergenic
1074788543 10:116863640-116863662 GTATCCCAGCCCCATCCTACTGG - Intronic
1075017888 10:118924388-118924410 CTCACCCAACCCCCACCTTCTGG - Intergenic
1075493692 10:122899159-122899181 CTCTCCCATCCTCCCCCTTTTGG + Intergenic
1075724643 10:124605041-124605063 GTCTCCCTGCCGCCTCCTCCAGG - Intronic
1075944847 10:126423989-126424011 CTTCCCCAGCCCCCTCCCTGAGG + Intergenic
1076150096 10:128154805-128154827 TACTCCCAGCCCCCTCCTCTGGG + Intergenic
1076321390 10:129584639-129584661 ATTTCCCATCCCCCTCCCTCTGG + Intronic
1076854513 10:133109272-133109294 CTCTCCCAGCCCCCGCTCCCTGG + Intronic
1077006985 11:363102-363124 CTCTCCCGGCCCCCACCGTCTGG + Intergenic
1077007033 11:363246-363268 CTGTCCCGGCCCCCACCGTCTGG + Intergenic
1077007042 11:363277-363299 CTGTCCCGGCCCCCACCGTCTGG + Intergenic
1077007128 11:363563-363585 CTGTCCCGGCCCCCACCGTCTGG + Intergenic
1077007164 11:363680-363702 CTGTCCCGGCCCCCACCATCCGG + Intergenic
1077007184 11:363742-363764 CTGTCCCGGCCCCCACCGTCTGG + Intergenic
1077054570 11:584650-584672 CCTTCCCATCCCCTTCCTTCGGG - Intronic
1077290029 11:1784827-1784849 TTCTCCCAGACCCCTTCTCCTGG + Intergenic
1077349955 11:2088424-2088446 CCCTCCCACACGCCTCCTTCAGG + Intergenic
1077384263 11:2261599-2261621 CTCTGCCCACCCCCTCCTCCTGG - Intergenic
1077488689 11:2850668-2850690 CTCCCGCAGCCCCTTTCTTCGGG + Intergenic
1078935229 11:15943628-15943650 CTGGCCCAGCCCCCACCTGCTGG + Intergenic
1079353885 11:19714487-19714509 CTGTCCCTGCCCCATCCTGCGGG + Intronic
1081528944 11:43944841-43944863 CTCTCCCAGACCCTCCCTCCAGG + Intergenic
1081625348 11:44652086-44652108 CTCTCCCGCTCCCCTGCTTCCGG + Intergenic
1081810218 11:45910223-45910245 CCCTCCCCACACCCTCCTTCCGG + Intronic
1083342495 11:61967704-61967726 CGCCCCGAGCCCGCTCCTTCCGG + Intergenic
1083594480 11:63912346-63912368 CTCTCCTAGCCTCCTCCATGGGG + Exonic
1083635312 11:64117640-64117662 CGCTCCCCGCCTCCTCTTTCCGG + Exonic
1083793182 11:64999161-64999183 CTCTCCCAGCTGCCTCCTCAGGG - Intergenic
1083826454 11:65206707-65206729 CTCTCCCAGCCTCCCCTCTCAGG + Intronic
1083989846 11:66240291-66240313 CTCTCTCTGCCCCCTGCTGCTGG - Intronic
1084180600 11:67443676-67443698 CCCGCCCCGCCCCCTTCTTCCGG - Intronic
1084274113 11:68043140-68043162 CTGGCCCCGCCTCCTCCTTCAGG + Intronic
1084320978 11:68373281-68373303 CCCTCTCAGCCCCTTCCTTGGGG - Intronic
1084763596 11:71292772-71292794 CTCTCCCTACCCCCTCTTTAAGG + Intergenic
1085007957 11:73112591-73112613 CTCTCCCTGCCTCCTCTTTAAGG + Intronic
1085044320 11:73344378-73344400 CTCTCCCAGCCTCCTCCCTGCGG - Intronic
1085251535 11:75147320-75147342 CTCCCCCAGCCACCACCTCCAGG - Intronic
1085312867 11:75526250-75526272 CTCTCGCCTCTCCCTCCTTCCGG - Intergenic
1085450633 11:76630049-76630071 CCCTCCCAGCACCCTCCTCCTGG + Intergenic
1087152732 11:94873016-94873038 CTCTGCCAGCCCCTACCATCAGG + Exonic
1087260937 11:96011563-96011585 CTCTCCCACCCTCCCCCTTTTGG - Intronic
1088918855 11:114247142-114247164 CTCTCCCTGCCCCCTCTTCAGGG - Intronic
1090389921 11:126381971-126381993 CCCTCCCAGCCCACTCATCCAGG + Intronic
1090409917 11:126501062-126501084 CTCTCCCAGCCTCCTCCTCTGGG + Intronic
1090493870 11:127190998-127191020 CTCTCCAAGCCCCATCCTTTTGG + Intergenic
1090662121 11:128890289-128890311 CCCTGCCAGCCCCCTCTCTCAGG - Intergenic
1091176430 11:133562561-133562583 CTCCCCCTACCCCCACCTTCAGG + Intergenic
1091422158 12:351202-351224 CTCCCCTAGCCCCCTACTCCCGG + Intronic
1091705538 12:2690878-2690900 GGCTCCCACCCCGCTCCTTCAGG + Exonic
1091985882 12:4910051-4910073 CTCGCCCGCCCGCCTCCTTCGGG + Exonic
1092137817 12:6161785-6161807 CTGACCCAGCTTCCTCCTTCTGG - Intergenic
1092591067 12:9953236-9953258 CTCTGCCCGCCCCCCCCTACTGG + Intronic
1093749445 12:22781454-22781476 CTCTCCCACCGCCCACCTTTAGG - Intergenic
1093927864 12:24926390-24926412 CTCTGCCAGGCCACCCCTTCTGG + Intronic
1093942733 12:25072128-25072150 CTCACTCAACCTCCTCCTTCCGG - Intronic
1094051977 12:26230145-26230167 TTCTCCCAGCAACCTCCTACTGG + Intronic
1094527696 12:31243351-31243373 TTCTGCCAGGCCCCTCCATCTGG - Intergenic
1094821257 12:34227655-34227677 CTCTCCCACCCCCAGCCTACAGG + Intergenic
1095093648 12:38131131-38131153 CTCTCCCACCCCCACCCTACAGG - Intergenic
1095559646 12:43551006-43551028 CTCTCCCAGGCCCCGCGCTCCGG + Exonic
1095824701 12:46518781-46518803 CTTTCTCAGCCTCCTCTTTCTGG - Intergenic
1096521312 12:52186246-52186268 TTCTTCCAGCTCCCTCCTGCAGG + Intronic
1096521454 12:52186951-52186973 TTCTTCCAGCTCCCTCCTGCAGG + Intronic
1096529216 12:52232945-52232967 CTCTCCAAGCATCCTCCTCCGGG + Intronic
1096760984 12:53841873-53841895 CTCTCCCCGCACTCTCCTTCTGG + Intergenic
1096817161 12:54208838-54208860 CCCAGGCAGCCCCCTCCTTCTGG - Intergenic
1100116742 12:91314725-91314747 CTCTCCCAGTCCCCAGCTCCTGG + Intergenic
1100480103 12:94969683-94969705 CTCTCCCTGCACCCACCTTGTGG - Intronic
1101074235 12:101111813-101111835 CTATCACAGGCCTCTCCTTCTGG - Intronic
1101345082 12:103879155-103879177 GTCCCCCAACCCCCTCCTTTGGG + Intergenic
1101515269 12:105429308-105429330 CTCTCCCAGTCTCCTCATTTAGG - Intergenic
1101662113 12:106774900-106774922 CTTCCCCACCCCCCTCATTCCGG + Exonic
1102330240 12:112022619-112022641 CTTTCTCGGCCCCCTTCTTCTGG - Exonic
1102397526 12:112599925-112599947 CTCTCTCAGCCTCAGCCTTCTGG + Intronic
1102496261 12:113321210-113321232 CCCTCCCAGCCTCCTCCCTCTGG - Exonic
1102954944 12:117053153-117053175 AGGTCCCTGCCCCCTCCTTCAGG + Intronic
1103246301 12:119460789-119460811 CTCTCCCATCCCCTACATTCAGG - Intronic
1103266599 12:119635973-119635995 CTCTCCCAACCCTGTCCTTTTGG + Intronic
1104041509 12:125134117-125134139 CTCTCCCACCCCCATGCCTCTGG - Intronic
1104658746 12:130593316-130593338 CACCCCCAGCCCCATCCTCCTGG - Intronic
1105745136 13:23370614-23370636 TTCTCCCTGCCCCCACCCTCTGG + Intronic
1106076683 13:26466365-26466387 CTCTCCCAGCCCCCTTCTATGGG - Intergenic
1106542915 13:30705863-30705885 CCTTCCCAGCCCTCTCCTCCAGG - Intergenic
1108937532 13:55902204-55902226 CCCTCCCATCCTCCTCCTTCTGG - Intergenic
1110430695 13:75419689-75419711 GTCTCCCAGTCACCTCCATCTGG + Intronic
1110443201 13:75548361-75548383 CTCTCCCACCCACGTTCTTCTGG - Intronic
1111676899 13:91399073-91399095 CTTTCGCTGCCTCCTCCTTCTGG + Exonic
1111951465 13:94712183-94712205 GTCCCCCAGCCCCCTCCTCCGGG - Exonic
1112066888 13:95802639-95802661 CTCGTCCAGCCTCCTCCATCAGG - Intronic
1114329307 14:21619961-21619983 CTCTCCCAGCCCCCAATTCCTGG + Intergenic
1114664697 14:24370502-24370524 CCATGCCAGCCACCTCCTTCCGG - Exonic
1114745334 14:25140215-25140237 TGCTCCCAGCACACTCCTTCTGG + Intergenic
1115444990 14:33479767-33479789 CTTTGCCAGCTCCCTCTTTCTGG + Intronic
1115473763 14:33794883-33794905 CCCTCCCACCCCCATCATTCTGG + Intronic
1117406809 14:55411883-55411905 CTTCCCCAGGCCCCTCCTCCTGG - Intergenic
1117837759 14:59825378-59825400 TTCTCCCAGCCCTTTCCTGCAGG + Intronic
1118124180 14:62881473-62881495 TTCTCCCACCCTCCGCCTTCTGG - Intronic
1118351016 14:64972388-64972410 CGCTCCCCGCCCCCTCTCTCCGG - Intronic
1118358939 14:65039587-65039609 CTCTCCCATCCCTATCCTTTGGG + Intronic
1118734148 14:68690177-68690199 CTCTCCCTACCCCCTCCTCATGG - Intronic
1119693363 14:76694032-76694054 CCCTGCCAGCCCCCTGCCTCAGG - Intergenic
1119890076 14:78175733-78175755 CACTCCCAGCCCTTTCCTGCAGG + Intergenic
1120092785 14:80353026-80353048 CTCCCCCAGCCCCCACCGACAGG + Intronic
1120250714 14:82059397-82059419 CTCTCCCAGCCCGCACCTATGGG - Intergenic
1120519257 14:85507631-85507653 CTCTCCCAGCACCCTCCCAGGGG - Intergenic
1120747515 14:88165601-88165623 CTCTCCCAACCCCCACTTTCGGG - Intergenic
1121113828 14:91330222-91330244 GTCTCCCAGCCTCCTGCTCCAGG - Intronic
1121270295 14:92633139-92633161 CTCCCCCTGCTCCCTCCCTCAGG - Intronic
1122025497 14:98872989-98873011 CTCTCCCTTTCCCCTCCTCCTGG + Intergenic
1122027248 14:98886889-98886911 CTCTCCCTGCCCCATTCTTCTGG - Intergenic
1122058588 14:99121740-99121762 CTCACCTAGCCCCTTCCTCCAGG + Intergenic
1122279185 14:100611070-100611092 CTCTCCCAGCCCTCTCCGCTGGG + Intergenic
1122298846 14:100720411-100720433 CTGTGCCTGCCCCCTCCTTGGGG + Intergenic
1122393618 14:101407464-101407486 CTCTGCCAGCCGCCTTCTCCAGG + Intergenic
1122688043 14:103519161-103519183 CCCTCCCAGCCTCGGCCTTCAGG - Intergenic
1122753012 14:103953273-103953295 CTCTTCCCGCCCCCTCCTGTGGG + Intronic
1122829939 14:104390951-104390973 CTCTCCCGGAGCCCTCCCTCTGG - Intergenic
1123121255 14:105918085-105918107 CCCTCCCTCCTCCCTCCTTCAGG - Intronic
1123130511 14:105981916-105981938 CTCCCCTAGCAGCCTCCTTCAGG + Intergenic
1202848667 14_GL000225v1_random:1949-1971 TTCCCCCAGCCCCCTCCACCGGG + Intergenic
1123499581 15:20867390-20867412 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1123556833 15:21441120-21441142 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1123593056 15:21878356-21878378 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1124113121 15:26811497-26811519 CCCTCCCACCCTCCACCTTCAGG - Intronic
1124959931 15:34386536-34386558 GGCCCCCAGCCCCCTTCTTCAGG + Intronic
1124976558 15:34532757-34532779 GGCCCCCAGCCCCCTTCTTCAGG + Intronic
1125031846 15:35082246-35082268 CTCTGCCAGGCCGCCCCTTCTGG + Intergenic
1125097824 15:35874830-35874852 CTATCTCCTCCCCCTCCTTCAGG + Intergenic
1125516391 15:40323618-40323640 CTCTCCCCGCCCCCTGTTGCCGG + Intergenic
1126675529 15:51156785-51156807 CCCTCCCTGCCCCCTCCTCCAGG - Intergenic
1128065069 15:64759357-64759379 GTCACCCAGCCCTCTCTTTCAGG + Intronic
1128068049 15:64776171-64776193 GTCTCCCAACCCCCTCCCCCCGG - Intergenic
1128153622 15:65378100-65378122 CTCCCCCAGCCCCCTCTCCCCGG + Intergenic
1128247567 15:66143521-66143543 CTCTCCCTGGCACCTCCTTCAGG + Intronic
1128336231 15:66787389-66787411 CTCACCCCTCCCCCACCTTCAGG + Intergenic
1128338792 15:66805396-66805418 CTCTGCCAGCCCTGGCCTTCTGG - Intergenic
1128599102 15:68980472-68980494 CTCTCCCAGGCCCTTCCTCATGG - Intronic
1129136227 15:73554600-73554622 CTTTCCCATCCCCCTCCCTGGGG - Intronic
1129155811 15:73716908-73716930 TCCTCCCAGTCTCCTCCTTCTGG - Intergenic
1129226342 15:74172706-74172728 CTCTTCCAGCTCCCTCGTTTTGG + Intergenic
1129235912 15:74223630-74223652 GACTCCCAGCCCCCACCCTCTGG + Intergenic
1129245912 15:74278538-74278560 ATCTCCCATCTCCCACCTTCTGG + Intronic
1130741351 15:86603664-86603686 CTCTTCCCGCCCCCTCCATCTGG + Intronic
1130996855 15:88908891-88908913 AGCCCCCCGCCCCCTCCTTCTGG + Intronic
1202965176 15_KI270727v1_random:168309-168331 TCCTCCCAGCCCCCTCTTGCAGG - Intergenic
1132604477 16:788065-788087 CCCTCCCCGCCCCCACCGTCGGG - Intronic
1132668126 16:1091085-1091107 CTCGCCCATCCCCCTCTTTAGGG - Intronic
1132868148 16:2103968-2103990 TTCTCCCAGCCCCCACCCTCCGG - Intronic
1133109094 16:3535034-3535056 CTCTGCCTGCCCCTTCCTCCCGG - Intronic
1133299994 16:4776557-4776579 CTGTCCCAGCCCCTTACTCCTGG - Intergenic
1133311800 16:4852989-4853011 CTGCCCCAGCCTCCTCCTTCCGG - Exonic
1133381751 16:5336747-5336769 CCCTCCAGCCCCCCTCCTTCTGG + Intergenic
1133545195 16:6799573-6799595 CTCTCCCAGGCCGCTCCCTCAGG - Intronic
1133699151 16:8293046-8293068 CTCCCCCACCCCCCAGCTTCTGG - Intergenic
1134523626 16:14929156-14929178 TTCTCCCAGTCCCCACCCTCCGG + Intronic
1134549272 16:15131780-15131802 TTCTCCCAGCCCCCACCCTCCGG - Intronic
1134628619 16:15740879-15740901 CTCTCTCAGATCACTCCTTCTGG + Intronic
1134711218 16:16327641-16327663 TTCTCCCAGTCCCCACCCTCCGG + Intergenic
1134948356 16:18340942-18340964 TTCTCCCAGCCCCCACCCTCCGG - Intergenic
1134955611 16:18381052-18381074 TTCTCCCAGTCCCCACCCTCCGG - Intergenic
1135061598 16:19275688-19275710 CTCTCCCAGCCTGCACCTTTGGG - Intergenic
1135265516 16:21022254-21022276 CTATCTCAGCATCCTCCTTCAGG + Intronic
1135381249 16:21997924-21997946 CTCCCCCAGCTCCCTACCTCTGG + Intronic
1136012674 16:27374235-27374257 CTCGCCAAACCTCCTCCTTCTGG + Intergenic
1136136629 16:28260303-28260325 CTCTCCCCACCCCCACCTGCAGG + Intergenic
1136173006 16:28499526-28499548 CTCTTCCAGCCCCCTGCCCCAGG - Exonic
1136228204 16:28872768-28872790 CCCTCCCCGCCCCATCTTTCTGG - Intronic
1136377510 16:29873995-29874017 CTCTCCCAGCCCTAAGCTTCTGG - Intronic
1136399335 16:30009359-30009381 CTGCCCTTGCCCCCTCCTTCTGG - Intronic
1137401052 16:48154942-48154964 CTCCCACAGCCCCTTCCTCCAGG + Intronic
1137677102 16:50309171-50309193 CTCTCCCAGACCCCGCATCCTGG + Intronic
1138093227 16:54193571-54193593 CTCTGCCATCCCCCTGCCTCAGG - Intergenic
1138495183 16:57404465-57404487 CTCTGCCAGCCCCTTCCTTCCGG - Intergenic
1138552688 16:57756091-57756113 CTCTCCCCTCCCCCTGCTTCAGG - Intronic
1138654912 16:58485590-58485612 CTCTCCCAGCCCCCACACCCTGG + Intronic
1138717400 16:59039566-59039588 TTCTCCCAGCCCCCTACCTCCGG - Intergenic
1140042651 16:71419086-71419108 CTCTCCCAGCCCCTGTCTTGCGG - Intergenic
1140213095 16:72986202-72986224 CTCACCCTGCCCCCAACTTCAGG + Intronic
1140508727 16:75492047-75492069 CAGTCCCAGCCCCCTGCCTCTGG - Intronic
1140550582 16:75861544-75861566 CCCTCCCAGCTGCCTCCTTGTGG - Intergenic
1141180854 16:81752589-81752611 CTCTCCCAGCCCCTCCTTTGGGG - Intronic
1141391813 16:83671071-83671093 TTCCCCCAGTCTCCTCCTTCTGG + Intronic
1141482034 16:84313166-84313188 CTCCCTCAGCCCCCTCCCTCGGG - Intronic
1141511359 16:84514314-84514336 CTCACTCAGCCCCCACCATCTGG + Intronic
1141613975 16:85199839-85199861 CTCTCCCAGCCACCAGCCTCTGG - Intergenic
1141952000 16:87345306-87345328 CCCTCCCCGCACCCTCCTGCTGG - Intronic
1142151982 16:88516717-88516739 CTCTCCCCGACCCCTCCCTGAGG + Intronic
1142227374 16:88884212-88884234 ATCTCCCAGCCCCCACCTTGCGG - Intronic
1142236555 16:88925200-88925222 CTCTCCCAGCCCCCGGCCTTGGG + Intronic
1142438974 16:90082193-90082215 CTCTCCCAGCCGCGTCCTGAGGG - Intronic
1142709823 17:1716895-1716917 CTCGCCCAGCCCACTCCTCCTGG + Intronic
1142763027 17:2052307-2052329 CTCTCCCTGCCCCGCTCTTCCGG - Intergenic
1142876236 17:2853499-2853521 CTCCCCTCGCCCGCTCCTTCTGG - Intronic
1142909027 17:3071564-3071586 GTCTCCCAGCCCACTCCAGCAGG + Intergenic
1142925535 17:3232678-3232700 GTCTCCCAGCCCACTCCAGCAGG - Intergenic
1143477932 17:7213597-7213619 CACTCCCAACCGCCTCCTTCAGG + Intronic
1143762784 17:9117003-9117025 CTCTCCCACCCCCCTCATTCAGG - Intronic
1143768040 17:9150458-9150480 CTCTCTCTGCCACCTCCTTCGGG - Intronic
1144611796 17:16725820-16725842 CTCTCCCAGCCAGATACTTCTGG + Intronic
1144900943 17:18589566-18589588 CTCTCCCAGCCAGATACTTCTGG - Intergenic
1145131563 17:20356501-20356523 CTCTCCCAGCCAGATACTTCTGG + Intergenic
1145239918 17:21234960-21234982 CTCACTCAGCCACCTTCTTCTGG + Intergenic
1145317367 17:21742959-21742981 ACCTCCCAGCCCCCACCCTCAGG + Intergenic
1145942439 17:28749705-28749727 CTCCCCCAGCCACCACCCTCAGG + Exonic
1146389547 17:32409089-32409111 CTCTCCCAACCCCCGCCTTCCGG + Intergenic
1147166336 17:38595631-38595653 TTCTCCCATCCCCCACCCTCTGG + Intronic
1147609781 17:41794632-41794654 CCTTCCCAGCCTCCTCCTCCAGG + Intergenic
1148046649 17:44748907-44748929 CTCTCCCAGACCCCTTCCCCTGG + Intronic
1148407316 17:47427776-47427798 CTCTCCCTTCCCCTTTCTTCTGG + Intronic
1149678659 17:58488350-58488372 CTCGCCCTGCCCGCTCCTGCCGG + Exonic
1149781385 17:59399237-59399259 CTCTCCCTTCCCCCTCCTCAAGG + Exonic
1149985618 17:61344765-61344787 CTCTCCCACTCCCTTCCTTTTGG - Intronic
1149994514 17:61399727-61399749 TTCTCCCAGGCCCCCCCTCCCGG + Intergenic
1150132563 17:62677247-62677269 GTCTCCCTTCCCTCTCCTTCAGG + Exonic
1150135806 17:62694358-62694380 CTCACTCCGCCACCTCCTTCAGG - Intergenic
1150762459 17:67974829-67974851 CTCTCCGAACCCGGTCCTTCTGG + Intronic
1151255232 17:72871601-72871623 CTCTCTGAACCCCGTCCTTCTGG - Intronic
1151322761 17:73361515-73361537 CTCCCCCCGCTCCCTCCTCCCGG - Intronic
1151448095 17:74180477-74180499 CTCTCCCCGCCCCGTGCCTCCGG - Intergenic
1152044073 17:77924505-77924527 ACCTCCCACTCCCCTCCTTCTGG + Intergenic
1152226161 17:79093878-79093900 CTGCCCCAGCCTCCTCCCTCAGG - Intronic
1152337553 17:79707082-79707104 CTCTTGCCGCCCCCTTCTTCTGG - Intergenic
1152558579 17:81066827-81066849 GTGTCCCAGCCTCCTCCTGCAGG + Intronic
1152794058 17:82298267-82298289 CCCTCCCAGCCCACAACTTCCGG - Intergenic
1152926045 17:83088225-83088247 CTCTGCCACCCCCATCCTGCGGG - Intronic
1153556252 18:6316841-6316863 CTCCCCCAGCCACCTCTGTCAGG + Intronic
1153703750 18:7723774-7723796 CTCTCCCAGCCCGCGCCCCCAGG - Intronic
1154305912 18:13230821-13230843 CTCTCCTAGGCTCCTCTTTCTGG + Intronic
1154307564 18:13241682-13241704 CTGTCCCAGCCTCCTGCTGCAGG + Intronic
1154483523 18:14857546-14857568 CTCTGCCAGCCCGCCCCATCTGG - Intergenic
1154483944 18:14859166-14859188 CTCTGCCAGCCCGCCCCATCTGG - Intergenic
1154943427 18:21137569-21137591 CTCTGCCAGGCCACCCCTTCTGG - Intergenic
1156095942 18:33531682-33531704 CTCCCCCAGCCCCCTCTGACAGG - Intergenic
1156957875 18:42990835-42990857 ATCTCCCAACCCCCTCCTATTGG - Intronic
1158447479 18:57533731-57533753 CCCTCCCAACACCCTCCTGCTGG + Intergenic
1158925978 18:62260898-62260920 CTCCCCCAGACCCCAGCTTCTGG - Intronic
1158940438 18:62402380-62402402 TTCTGCCAGCTCCCTCCTGCAGG + Intergenic
1159148182 18:64482071-64482093 CTCACCCCTCCCCCTCCTTCTGG + Intergenic
1159804373 18:72938335-72938357 CTCTCACATCCTCCTCTTTCCGG + Intergenic
1159839565 18:73382805-73382827 AACTCACAGCCCCCTCCTACAGG - Intergenic
1159944854 18:74436820-74436842 CACCCCCACCCCCGTCCTTCAGG + Intronic
1159955742 18:74517160-74517182 CTCACCCAGGCCCACCCTTCTGG + Intronic
1160427414 18:78787791-78787813 GTCTCCCAACTCCCACCTTCCGG + Intergenic
1160900256 19:1424358-1424380 CTCCCCCCTCCCCCTCCGTCTGG + Intronic
1160920973 19:1520397-1520419 CCTCCCCAGCACCCTCCTTCCGG - Intergenic
1161026584 19:2039952-2039974 CCCTCCCAGCCCCCACCCTGGGG + Intronic
1161081570 19:2313033-2313055 CTCTCCCTGCCCCCGCCCCCCGG + Intronic
1161207864 19:3051215-3051237 CACTCCCAGCCCTCTCCTCAGGG + Intergenic
1161242292 19:3229090-3229112 CTCCCCCCGCCCCCCGCTTCAGG + Intronic
1161400600 19:4065232-4065254 CTCTCTCCGCCCCCTCCCGCGGG + Intronic
1161715761 19:5875431-5875453 CTTTCCCCGCCCACTCCTGCAGG + Intronic
1161799868 19:6411691-6411713 CACACCCAGCCCCCTTGTTCGGG + Intergenic
1162145682 19:8611143-8611165 CTCACTCAGCCCCTTCCTCCAGG - Intergenic
1162312387 19:9914669-9914691 CGCTCCCGGCCCGCTCCCTCGGG + Intronic
1162930009 19:13952896-13952918 CCCTCCGAGCCCCCTCCCTGGGG - Intronic
1163116001 19:15188938-15188960 CTGTCCCCGCCCCCTGCCTCAGG + Intronic
1163189526 19:15666391-15666413 CTCCCCCAGCCTACTCCTTTGGG - Intergenic
1163290644 19:16377083-16377105 CTCTCGCAGCCACCGCCTACCGG - Intronic
1163290677 19:16377241-16377263 CTCTTACAGCCCCCACCTTCTGG - Exonic
1163459022 19:17425155-17425177 CTCGACCCGCCCCCTCCTCCAGG - Exonic
1163632651 19:18425192-18425214 CCTTCGCAGCCCCCTCCTTCAGG + Intronic
1163767664 19:19172348-19172370 ACTCCCCAGCCCCCTCCTTCTGG + Intronic
1164603005 19:29576231-29576253 CTCTCCCAGGCACCGCCTGCTGG - Intergenic
1164792938 19:31003381-31003403 TTCCTCCAGCCTCCTCCTTCTGG - Intergenic
1165158588 19:33802886-33802908 CTCTCCCACCCGCCTCCCCCAGG - Intronic
1165489645 19:36115729-36115751 CCCTCCCAGCCTCCCCCTTCCGG - Intronic
1165745640 19:38228539-38228561 CGCTCCCCTCCCCCTCCTCCCGG - Intronic
1165953640 19:39488689-39488711 CTGCCCCAGGCTCCTCCTTCAGG - Intronic
1166268796 19:41701143-41701165 CTCTCACAGCCCCCGCCTCTAGG + Intronic
1166567149 19:43772211-43772233 CCCTCCCATCCCCTTCCCTCTGG + Intronic
1166706436 19:44910526-44910548 CTCCCCCAACCCCCTTCATCTGG + Intergenic
1166982609 19:46639813-46639835 CTCCCCCATCCCCCAGCTTCTGG - Intergenic
1167077060 19:47256614-47256636 CGCTCCCGGCCCCCTCCCCCAGG - Intronic
1167311154 19:48738827-48738849 CCCTCCCAGTCCCCTCCCGCGGG + Intronic
1167318486 19:48780646-48780668 CTCTCCCACCCCCATACTTTAGG - Intergenic
1167422706 19:49413509-49413531 CTCTCCCCCTCCCCTCTTTCAGG + Intronic
1167435348 19:49475629-49475651 CACACACAGCCCCCTCCTCCGGG - Intronic
1167456877 19:49601045-49601067 GTCTGCCAGCTCCCTTCTTCAGG - Intronic
1168246754 19:55116457-55116479 CCTTCCCTGCCGCCTCCTTCAGG - Intronic
1168273561 19:55263795-55263817 CTCTCTCCTGCCCCTCCTTCTGG - Intronic
1168309192 19:55452149-55452171 CGCCCCCGGCCCCCGCCTTCCGG - Intergenic
1168311968 19:55464998-55465020 CCCTCCCAGCCCCCTCCCCACGG - Intergenic
925039429 2:719758-719780 TTCTTCCAGCCCCCTCAATCTGG + Intergenic
925987835 2:9230547-9230569 CCCTCCCACACCCCTCCTGCAGG - Intronic
927175150 2:20400562-20400584 CTCTCCAAACCCCCTCATTTAGG - Intergenic
927754566 2:25698366-25698388 CATTCCAAGCCCCTTCCTTCTGG - Intergenic
928288699 2:30018058-30018080 TTGTCCCAGCTCCTTCCTTCTGG - Intergenic
928452373 2:31388128-31388150 CTCTTCCAGCCCCCACCGCCAGG + Intronic
928627351 2:33153938-33153960 TTCCCCCAGCCCCCTCCTGCAGG + Intronic
929433229 2:41906520-41906542 CTCTGGCATCCCCCTCCTCCAGG - Intergenic
929551176 2:42893170-42893192 CTCACCCAGCCCCTACCTTCAGG - Intergenic
931081410 2:58775706-58775728 CTGTCCCAGCAACCTCATTCTGG - Intergenic
931976523 2:67649800-67649822 CTCTCCATGCCCACTCCTTTAGG + Intergenic
932099291 2:68882200-68882222 CTCTCCAAGGCCCCTCTCTCTGG - Intergenic
932404639 2:71505008-71505030 CTCTCCCATCCGCCACCTCCTGG - Intronic
932462569 2:71892537-71892559 CTCTCCCAGGCCCCTCCTTGGGG - Intergenic
933750781 2:85601191-85601213 CTCTCCCAGACCTCCCCTACAGG + Intronic
933939909 2:87236448-87236470 CCCTCCCAGCCCCCTGTTCCAGG + Intergenic
934025507 2:87998818-87998840 CTCTCCAAGCCCTGTCCTTTTGG - Intergenic
934517311 2:94996816-94996838 CTCTCCCAGCACCCTCCTTTTGG - Intergenic
934780385 2:96966143-96966165 CCCCACCAGCCCCCTCCTCCAGG + Intronic
935211864 2:100945533-100945555 TTCTGCCACCCCCTTCCTTCAGG + Intronic
936403235 2:112181942-112181964 CTCACCCACCGCCCTCCTGCCGG + Intronic
937104243 2:119295114-119295136 CTGTCTCAGCCACCTCCTCCTGG - Intergenic
937239634 2:120451810-120451832 TTCTTCCAGGTCCCTCCTTCTGG - Intergenic
937915676 2:127097624-127097646 CTGGCCCAGGCCACTCCTTCTGG + Intronic
938019192 2:127892306-127892328 CTCTCACAGCCTCTTCCTTCTGG - Intergenic
939231277 2:139429285-139429307 CTCCCCCACCCACCTCCATCAGG + Intergenic
939232670 2:139450443-139450465 TTCACCCAGTCCCCTCCTTCCGG + Intergenic
939343784 2:140935577-140935599 CGCTCCCTTCCTCCTCCTTCTGG - Intronic
942209004 2:173651878-173651900 CTCTCCCACCTCCCCCCTTTTGG + Intergenic
943142406 2:183999008-183999030 CTCCCCCACCCGCCTCCTGCTGG + Intergenic
943910045 2:193552457-193552479 CTCTCTCTTCCCTCTCCTTCTGG - Intergenic
944674430 2:202023366-202023388 CACTCCTCGGCCCCTCCTTCAGG + Intergenic
945190678 2:207184573-207184595 TTCCCCCAGCCCCCTTCTTAAGG + Intergenic
946409233 2:219508183-219508205 CTCTCCCAGCCCCTTCCTTGGGG - Intergenic
946416980 2:219544624-219544646 CTCTCCCACCCCCATCCTGGTGG + Intronic
947206653 2:227667150-227667172 CTCTCCCAGACCTCCCCATCTGG + Intergenic
947280930 2:228453989-228454011 CCCTCCCACCCCTCTCCCTCTGG + Intergenic
947650231 2:231780795-231780817 CTCTCGCAGCCCCGTCCCCCAGG + Intronic
948869115 2:240789476-240789498 CTGTCTCTGCCCCCTCCTTATGG + Intronic
949000116 2:241608312-241608334 CTCTCCCACTCTCCTGCTTCAGG - Intronic
1170026886 20:11898362-11898384 CCCCCCCAGCCACCTCTTTCAGG + Intronic
1170534925 20:17331188-17331210 CTCTTCCAGCCCACTCCTTGTGG + Intronic
1170536498 20:17346109-17346131 CCCACCCAGCATCCTCCTTCTGG + Intronic
1170991131 20:21303036-21303058 ATCTCCCAGCCCCAGCCCTCCGG - Intergenic
1171040988 20:21763388-21763410 ATCCCCCAGCCCCGTCATTCTGG - Intergenic
1171255218 20:23685303-23685325 CACAACCAGCCCCCTCCTCCTGG + Intergenic
1171271705 20:23823433-23823455 CACAGCCAGCCCCCTCCTCCTGG + Intergenic
1171278106 20:23875783-23875805 CACAGCCAGCCCCCTCCTCCTGG + Intergenic
1171311923 20:24151490-24151512 GGCTCCCAGCTCCCTCCTGCTGG + Intergenic
1172113348 20:32560160-32560182 CTCTCCCAGCCCCGTCACACAGG + Intronic
1172120926 20:32598332-32598354 CACCCCCAGACCCCTCCTCCAGG + Intronic
1172146509 20:32762020-32762042 CTCTCTGAGCCCCCGCCTCCAGG + Intergenic
1172271123 20:33656428-33656450 CTCACCCAGCCCTCTCCCCCTGG + Intergenic
1172588452 20:36101261-36101283 CTCTCCAGGCCACCTCCCTCTGG - Intronic
1172624404 20:36338968-36338990 CCCTCTCAGCCTCCTCCCTCTGG - Intronic
1172851430 20:37969085-37969107 CTTTCCCTGCCCCCTCCTGGTGG - Intergenic
1172967956 20:38852076-38852098 ATCTCCTAGCCCCCTTTTTCTGG - Intronic
1173882796 20:46430868-46430890 CTCTGCCAACTCCCTTCTTCTGG - Intronic
1174353847 20:49985682-49985704 CCCTCCCAGCCCCCACCCACTGG - Intronic
1174489087 20:50879642-50879664 CTCTCCCTGGCCCCTGTTTCAGG - Intronic
1174649190 20:52110355-52110377 CGTTCTCAGCCCCCTTCTTCTGG + Intronic
1174804739 20:53594639-53594661 CCCTCGCGGCCCCCTCCCTCCGG - Intronic
1175871249 20:62210474-62210496 CTCTCCCAGCCTCCTCCAGCCGG + Intergenic
1175952390 20:62590493-62590515 CTCACCCAGCCTCCTCCGGCAGG + Intergenic
1176040079 20:63060672-63060694 TTCTCCCAGCCTCCTGCCTCGGG + Intergenic
1176168500 20:63686671-63686693 CCCTCCCAGCCCTTCCCTTCCGG - Intronic
1176179145 20:63741430-63741452 GTCCACCAGCCCTCTCCTTCTGG + Exonic
1176184594 20:63771380-63771402 CTCTCTCCCTCCCCTCCTTCTGG - Intronic
1176816519 21:13609073-13609095 TCCTCCCAGCCGCCTCTTTCAGG + Intergenic
1177807335 21:25887027-25887049 GTCTCCCCGCCCCCACCTCCTGG - Intronic
1179013601 21:37575337-37575359 CTCTCCAGGCCACCTCCTTTTGG + Intergenic
1179451429 21:41470895-41470917 CCCTGCCAGACCTCTCCTTCTGG + Intronic
1180029935 21:45200136-45200158 CTCACCCAGCCCCATCCACCTGG - Intronic
1180030503 21:45203278-45203300 GCCTCACAGCCCCCTCCTTTGGG + Intronic
1180101749 21:45590781-45590803 CTCTCCCAGGCTCCTGCTCCAGG + Intergenic
1180537276 22:16404265-16404287 CTCCCCCACCCCCCGCCCTCTGG - Intergenic
1181085854 22:20439007-20439029 CTCCTCCAGCCCCACCCTTCGGG - Intronic
1181508030 22:23374854-23374876 CTCTCCCAGTCCCCTGCATCTGG + Intergenic
1181549122 22:23626669-23626691 CTCGCCCAGCCTCCTACTGCAGG + Intronic
1181799543 22:25335494-25335516 CTCGCCCAGCCTCCTACTGCAGG - Intergenic
1182366395 22:29782253-29782275 CTCTCCCAGCCCGGTCCCTGTGG + Intergenic
1182429632 22:30292098-30292120 CTCCTTCAGCCCCCTCCTCCTGG - Exonic
1182441425 22:30366546-30366568 CTCTCCCAGCTGCCTCCTCAGGG + Intronic
1182711907 22:32328455-32328477 CTCTCCCAGAGCCCTCTTTTTGG + Intergenic
1183046710 22:35226386-35226408 CTCTCCCTTCCCTTTCCTTCTGG + Intergenic
1183377185 22:37472163-37472185 CTCTCCCAGCCCCAATCCTCTGG - Intronic
1183415771 22:37681046-37681068 CTCCCGCAGCCTCCTCCTTGGGG + Intergenic
1183451047 22:37895226-37895248 TTCCCCTAGCCCTCTCCTTCGGG - Intergenic
1183485525 22:38086007-38086029 CTCCCCCAGCCCCGTCCTACTGG + Intronic
1183489463 22:38108898-38108920 CCCTCATTGCCCCCTCCTTCAGG - Intronic
1183507571 22:38218161-38218183 CTTTCCCAGCCCCCACCTGCAGG + Intergenic
1183654615 22:39177375-39177397 CTCTCCCTCCCCTCTCCTGCTGG + Intergenic
1183987332 22:41576697-41576719 CACCCCCAGCCCCTTCCTTGGGG - Intronic
1184078879 22:42203742-42203764 CCCTCCCAGCCCCCTCTCTCTGG - Intronic
1184398268 22:44258456-44258478 CTCTCCCTTCTCCCACCTTCCGG + Intronic
1184399455 22:44265326-44265348 CTCTCCCAGAGCCCTCTTTTTGG + Intronic
1184508654 22:44919031-44919053 CTCACCCTGCACCCTCCTCCTGG + Intronic
1184545614 22:45164753-45164775 CCCTGCCAGCCCCCTACCTCCGG - Intronic
1184745058 22:46451261-46451283 CCTTCCCAGCTCCCTCCTTGTGG - Intronic
1184901863 22:47451322-47451344 CTCCCACAGCCTCCTCCTCCAGG - Intergenic
1184977938 22:48076331-48076353 CGCTCGAGGCCCCCTCCTTCTGG - Intergenic
1185130963 22:49038525-49038547 CTCCCCCAGCCCCCCGCCTCCGG + Intergenic
1185330308 22:50249281-50249303 CCCACCCAGCCCCCTCCCCCTGG - Intronic
950141776 3:10620697-10620719 GCCTCCCAGCTCCCTCCCTCAGG - Intronic
950160647 3:10758180-10758202 CTCTCCGAGCCCCTGCTTTCCGG + Intergenic
950198440 3:11026133-11026155 CATTCCCAGCCCCCTCCTCCGGG + Intronic
950504305 3:13384670-13384692 CTCTCCAAGCGTCTTCCTTCAGG + Intronic
950703519 3:14766361-14766383 CTCCCTCAGTCCCCTCCATCTGG - Intronic
951024323 3:17813921-17813943 GTGTCCTAGCCCCCACCTTCTGG - Intronic
951080167 3:18444142-18444164 CTCCCGCAGCCCACTCCTCCAGG + Intronic
951113019 3:18828066-18828088 ATCTCCCACCTCTCTCCTTCTGG - Intergenic
952195801 3:31074221-31074243 GTGTCCCAGCTCCCTCCTGCTGG + Intergenic
953964527 3:47293122-47293144 CTCTCCATTCCCCCTCCTCCCGG - Intronic
954131260 3:48562201-48562223 CCCTCACAGCCCCGTCCATCTGG + Exonic
954749770 3:52806875-52806897 CTCTCCCTGCCCCATCCCTCTGG + Intronic
956370078 3:68549721-68549743 CTCTCCAAACCCTGTCCTTCTGG + Intergenic
956458997 3:69453099-69453121 CTCTCCCATCCCCACACTTCTGG - Intronic
956731901 3:72204008-72204030 CTCTGCCAGCCTCCTACCTCTGG - Intergenic
956869645 3:73404170-73404192 CTCTCCCAGCCCACCCGTGCTGG - Exonic
960141050 3:114152241-114152263 CTCTCGAATCCCCCTCCTTGGGG + Intronic
960864308 3:122184352-122184374 CGCTCCCGGCGCCCGCCTTCGGG - Exonic
961365791 3:126398425-126398447 CTCTCCCAACCTGCTCCTTCTGG - Intronic
961745137 3:129059703-129059725 CTCTCCCCGCCTCCTGGTTCTGG - Intergenic
962327449 3:134447670-134447692 CTCTCCCCACACCCTCCATCTGG - Intergenic
962406424 3:135104309-135104331 CTTTCCCAGCCCACTCATTACGG - Intronic
962965378 3:140348874-140348896 TTCTCCCAGTCCCCTGCTTCTGG + Intronic
963604945 3:147405870-147405892 CTCTCCTAGCCACCCCCTTGGGG + Intronic
963956077 3:151255444-151255466 CACCCCCAGCCCCCTCCCCCTGG - Intronic
964620144 3:158713036-158713058 CTCCCCCAACCCCATGCTTCTGG - Intronic
964878783 3:161400392-161400414 CTCCCCCAACCCCCTCCGACAGG - Intergenic
965833407 3:172824370-172824392 CTCTCCCTCCCTCCTGCTTCTGG - Intergenic
966031251 3:175350516-175350538 CTCTCCCACCCCTACCCTTCTGG - Intronic
967054888 3:185823610-185823632 CCCTCCCTGCCCTCTCCTCCCGG + Intronic
968744429 4:2352369-2352391 CTCCCCCAGCCTCCTCCATGTGG - Intronic
968750617 4:2387087-2387109 CTGGCTCAGCCCCCTCCTCCAGG - Intronic
968810551 4:2797816-2797838 CTCTCCCAGCCTCCCACTCCTGG + Intronic
968927373 4:3556663-3556685 ATCTCCCAGCCTCCTCCCTGAGG + Intergenic
970361705 4:15315799-15315821 CACACCAAGCCTCCTCCTTCTGG - Intergenic
971737248 4:30470117-30470139 CTCTCCCCGCCCCTACCCTCTGG - Intergenic
972457484 4:39268918-39268940 CTCTCCCTACCCCAACCTTCAGG - Intronic
972984833 4:44750603-44750625 CTCTCCCAGCCCCTTCCGACAGG + Intergenic
976812478 4:89111527-89111549 CTCTCTAATCCCCCGCCTTCCGG + Intergenic
979852976 4:125596003-125596025 ATCTCCCACCCCCATCTTTCTGG - Intergenic
980933730 4:139206496-139206518 CTCTCCCTCTCCCCTCCCTCTGG + Intergenic
984101707 4:175495185-175495207 CGCTCCCAGAGCCCTCCTGCAGG - Intergenic
984622893 4:181973951-181973973 CTCTCCCAGCCTACCCCTGCCGG - Intergenic
985656340 5:1133437-1133459 CTCACCCAGCCCTCTCCCCCAGG - Intergenic
986377744 5:7149565-7149587 CTCTCCCCACCCCCAGCTTCTGG + Intergenic
986476545 5:8139702-8139724 CTCTCCTAGGCCCTACCTTCTGG + Intergenic
986575505 5:9208621-9208643 TTCTCCCAGGCTGCTCCTTCTGG - Intronic
987099400 5:14578906-14578928 CTGTGCCAGCCCCCTTCTTCAGG - Intergenic
988716749 5:33836249-33836271 TTGGCCCGGCCCCCTCCTTCAGG - Intronic
989110299 5:37900835-37900857 GTCTCCCATCTCCCTCCATCAGG - Intergenic
990285712 5:54298853-54298875 TTCTCCCAGACTCCTCTTTCTGG + Intronic
991772067 5:70049800-70049822 CGCTCTCAGCACCCTTCTTCCGG + Intronic
991851360 5:70925218-70925240 CGCTCTCAGCACCCTTCTTCCGG + Intronic
991917084 5:71615954-71615976 CAGTCCCAGCCCTATCCTTCAGG + Intronic
991977071 5:72193926-72193948 TTCTTCCAGTCCCCTTCTTCAGG - Exonic
992477549 5:77118391-77118413 CTCTCTCAGCCTCATCCTTCTGG + Intergenic
993014441 5:82519689-82519711 CTCTCCCTTCCCCACCCTTCAGG - Intergenic
993174639 5:84468307-84468329 CTCTCCCACCCGCCTCCTCTGGG + Intergenic
995637564 5:114211557-114211579 TTCTCCCACCCTCCTCCCTCAGG - Intergenic
997195695 5:131977850-131977872 CTCTCCCCACCCCCTCATTGAGG - Intronic
998177597 5:139911457-139911479 CTCTCTCAGCCCCCACCTTCTGG + Intronic
998377728 5:141702390-141702412 CACTCCCCGCCCCCACCTTTGGG + Intergenic
998443167 5:142178957-142178979 CTCTCCCTCCCCTCTCCTGCTGG + Intergenic
998897933 5:146820054-146820076 CTCTCCCAATCCCCTATTTCTGG - Intronic
999893870 5:156007686-156007708 CTCTGCCATCCCCCACCTACTGG - Intronic
1000714295 5:164621811-164621833 CTCTCCATGTCCCCTCCTCCTGG + Intergenic
1000984139 5:167848833-167848855 CTTTCCCAACCCCCTGCTACGGG + Intronic
1001045202 5:168365976-168365998 AACTCCCAGCCCCCACCCTCGGG - Intronic
1001311406 5:170613553-170613575 CTCTCCCTCCCATCTCCTTCAGG - Intronic
1001334029 5:170783138-170783160 GTCTCCCCGCCTCCTCCTCCTGG + Intronic
1001415115 5:171540180-171540202 TTCTCACAGGCCCCTCCTCCAGG + Intergenic
1001484588 5:172110650-172110672 CACCCCCGGCCCCCTCCTTCCGG - Intronic
1002064505 5:176645349-176645371 ATCTCACAACCCCCTACTTCGGG + Intronic
1002168034 5:177360085-177360107 ATCTCCCAGCCCCCTTCCTAGGG + Intronic
1003022575 6:2523800-2523822 CTTGCCCAGCTCCCTGCTTCTGG - Intergenic
1003034754 6:2632957-2632979 CCCTCCCAGCTCCTTCCTCCCGG + Intronic
1003188312 6:3851422-3851444 CTTTGCTAGCCCCCTCCTGCTGG - Intergenic
1003426683 6:6002606-6002628 CTCTCCCAGCGCCCAGCCTCGGG + Intronic
1004070089 6:12289800-12289822 CTCTTCAAGCCCCTTCCTGCGGG - Intergenic
1004931125 6:20464135-20464157 CTCTCCAAACCCAGTCCTTCGGG + Intronic
1005095501 6:22110325-22110347 TTCTCTCTTCCCCCTCCTTCTGG - Intergenic
1006379185 6:33687860-33687882 CTCTCCCACTCCCCTCCCTTTGG + Intronic
1006381405 6:33699878-33699900 CTCTCCGGCCCCCCTCCTTAGGG + Intronic
1006472257 6:34235709-34235731 CTGGCCCAGCCCCCTCCTCAGGG - Intergenic
1006748075 6:36358996-36359018 CTCTCCCATCCTCTTCCTTTGGG - Intronic
1007119743 6:39369988-39370010 CTCTCCCAGCCTACCCCTCCAGG + Intronic
1007288910 6:40769415-40769437 CTCTCCCAGCTCCTCCCTTGGGG + Intergenic
1007569394 6:42878712-42878734 CTCACGCAGCCTCCGCCTTCTGG + Intergenic
1007634738 6:43292515-43292537 CAGCCCCAGCCACCTCCTTCAGG - Intergenic
1007837313 6:44683669-44683691 CTCTCCCAGCCCCCTTTCTTGGG + Intergenic
1008947367 6:57113137-57113159 CTCTCCCTCCTCCCTCATTCAGG + Intronic
1009622611 6:66096707-66096729 CTCTTCCAGGCCGCCCCTTCTGG - Intergenic
1009930512 6:70172307-70172329 CTCTCCCTCTCACCTCCTTCAGG - Intronic
1010366269 6:75055402-75055424 ATCCCCCAGTCCCCTCCTTGTGG - Intergenic
1011668208 6:89656469-89656491 CTCTCCCCGACCCCTGATTCCGG - Intronic
1012450727 6:99350048-99350070 CGCTCCCAGCCCCCGCCTGGTGG - Intronic
1013793019 6:113857599-113857621 CACCCCCACCCCCCTCCCTCCGG + Exonic
1013983298 6:116159773-116159795 TTCCCCCAGCCCCCACCTTTTGG + Intronic
1014420286 6:121235360-121235382 CTCTCCCTGCCCCCTCCTGGTGG - Intronic
1016056246 6:139580490-139580512 TGCTCCCACCACCCTCCTTCTGG + Intergenic
1016479482 6:144466882-144466904 CTCCTCCAGGCCCTTCCTTCTGG + Intronic
1016989029 6:149916753-149916775 CTCTCCCAGCCCCCTCCTTCTGG + Intergenic
1016993965 6:149947911-149947933 TTCTCCCAGCCCCCTCCTCCTGG - Intronic
1017004368 6:150019626-150019648 CTCTCCCAGCCCCCTCCTCCTGG + Intronic
1017011038 6:150064107-150064129 CCCTCACAGCCCCCTCGTCCTGG + Intronic
1017011417 6:150066241-150066263 CTCTGCCAGCCCAGCCCTTCAGG - Intronic
1018779918 6:167053881-167053903 TTCTCCCAGCCCCAACTTTCTGG + Intergenic
1018876685 6:167827363-167827385 CTCTCCCCTCCCCCTCCCCCAGG + Intronic
1019104384 6:169656653-169656675 CCATCCCAGCCTCCTCCTCCTGG - Intronic
1019358776 7:594384-594406 TGCTCCGAGCCCTCTCCTTCGGG - Intronic
1019471913 7:1225555-1225577 CTCTCCCGGCCTCCACCATCGGG + Intergenic
1019475908 7:1244147-1244169 GTGTCCCCGACCCCTCCTTCCGG + Intergenic
1019613129 7:1946943-1946965 CCCACCCAGCCTCCTCCTCCAGG - Intronic
1019634808 7:2069853-2069875 CTCTCCCTGTCCGCCCCTTCGGG + Intronic
1019895259 7:3977469-3977491 TTCCCCCAGCCCCTGCCTTCAGG + Intronic
1020006309 7:4785300-4785322 CTGTCCCACCCCCCTGCTCCCGG + Intronic
1020032861 7:4945071-4945093 CTCCCCCCGACCCCTTCTTCTGG + Intronic
1020194513 7:6026622-6026644 CTCTTCCAGCCCCAGCCTCCGGG + Intronic
1021123909 7:16827807-16827829 CTCTCTCTGCCTCCTCCTTAAGG - Intronic
1021692830 7:23247395-23247417 CTCTCCCAGCAAGCTCCTGCAGG - Intronic
1021737384 7:23653325-23653347 CTCTCCAAACCCCGTCCTTTTGG + Intergenic
1022066508 7:26864384-26864406 CTCTCCCTACCCCCTCCCTGAGG - Exonic
1022089105 7:27096312-27096334 GCCTCCCAGCCCCCACCTCCCGG - Intergenic
1023219048 7:37899519-37899541 CTCCCCCAGCCCCCACCGACAGG - Intronic
1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG + Intronic
1024044629 7:45578353-45578375 CTCTCCCAGCCCCTTGCTTTTGG + Intronic
1024047763 7:45596641-45596663 CTCACTCAGCCCCCATCTTCTGG - Intronic
1024260144 7:47568201-47568223 CTCTCCCTACCCTCTCCTGCAGG - Intronic
1024300533 7:47884253-47884275 CTCAGCGAGCCTCCTCCTTCAGG - Intronic
1024318840 7:48045514-48045536 GGCCCCCAGCCACCTCCTTCAGG + Intronic
1026498162 7:70921180-70921202 CTCGCCCACCCCAATCCTTCAGG - Intergenic
1026604211 7:71802082-71802104 CTCTTCCACCCTCTTCCTTCTGG + Intronic
1027233977 7:76287089-76287111 TGCTCCCAGCCCCCTCCTCCTGG + Exonic
1028441702 7:90870338-90870360 TTCTCCCAGCCTCCACCCTCTGG - Intronic
1029114508 7:98230452-98230474 CTCTCTCTGCCCACTCCTGCTGG + Intronic
1029746098 7:102516611-102516633 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1029764036 7:102615590-102615612 CCCTCCCACCCTCCTCCTCCAGG + Intronic
1030069157 7:105683964-105683986 CTCTGCAGGCCCCCTTCTTCAGG + Intronic
1032012625 7:128356837-128356859 CTCTCCCCACCCCCACCTCCAGG + Intronic
1032267531 7:130379803-130379825 ACTTCCCAGCCCCCTCCTGCTGG - Intergenic
1032285783 7:130537542-130537564 CTCTCCCAGCTCCCAGCTCCTGG - Intronic
1032286546 7:130541968-130541990 CTCTCCCAGCTCCCAGCTCCTGG - Intronic
1032480722 7:132244668-132244690 ATCTCCCAGGCCCCACCATCAGG + Intronic
1032567491 7:132961784-132961806 TTCTCCCAGTCCCCTGCCTCTGG + Intronic
1033159222 7:138981645-138981667 CTCCCCCAGGACCCGCCTTCCGG + Intergenic
1033347178 7:140534587-140534609 ACCTCCCATCCCCCTCCTTGAGG - Intronic
1033661534 7:143406322-143406344 CCCTCCCAACCCCATCCTTCTGG - Intronic
1034251228 7:149692587-149692609 CTCTCCCTGGCTGCTCCTTCAGG - Intergenic
1034522597 7:151632243-151632265 CCCTGCCAGGCCCCTCCTCCCGG - Intronic
1035558095 8:581632-581654 CTCTCTTAGCTCCTTCCTTCTGG - Intergenic
1036757018 8:11477436-11477458 CTCTCCCATCCCCTTCTTTCTGG + Intergenic
1037810328 8:22082787-22082809 CTCTACCAGCCTCCTCCCTGAGG - Intergenic
1038399777 8:27274686-27274708 CTCCCCCAGCCCCTCTCTTCTGG + Intergenic
1038776103 8:30532250-30532272 CACTCCCTGCCACCTCCCTCTGG + Intronic
1039576919 8:38631087-38631109 CTCTCACAGCCCACCCTTTCAGG - Intergenic
1039847100 8:41333223-41333245 CTCTCCCACATCCATCCTTCAGG - Intergenic
1039936735 8:42052065-42052087 CTCTTCCAGCTCCCTCCCCCAGG - Intergenic
1039947379 8:42141295-42141317 CTCTCACAGCCCCCTCCTCTTGG - Intergenic
1044589337 8:93898571-93898593 CTTTCCCGGGCCCCTCCTGCTGG - Intronic
1045017583 8:98012397-98012419 CTCCCACAGCCCCCTCCTCTGGG - Intronic
1046819639 8:118621454-118621476 TTTTCCCTGCCCCCTCCCTCCGG - Intronic
1047297541 8:123584504-123584526 CACTCCCAACCCTCTCCTCCTGG + Intergenic
1048095729 8:131291174-131291196 CTCTCTCAGCACCCTGCTTCTGG + Intergenic
1048308088 8:133297363-133297385 CGCTCCCTGCTCCCTCCTCCCGG + Exonic
1048636280 8:136299489-136299511 CTTTCACAGCCCTATCCTTCTGG - Intergenic
1049104209 8:140601263-140601285 CTCACCCACTCACCTCCTTCAGG + Intronic
1049423165 8:142525741-142525763 GTCTCCCAGCCTCCAGCTTCTGG + Intronic
1050802302 9:9630365-9630387 CTCTCCCTGCCTTCTCCTTTAGG - Intronic
1050986595 9:12091136-12091158 CCCTCCCAGCCACCTTCATCAGG - Intergenic
1051400965 9:16681909-16681931 GTCCCCCAACCCCCTCTTTCAGG - Intronic
1053066929 9:35075520-35075542 CTCTGCCACCCACCTGCTTCAGG - Exonic
1053142342 9:35689858-35689880 CTCACCCAGCCCAGTCCGTCCGG - Exonic
1053175051 9:35916448-35916470 CCAGCCCAGCCCCCTCCTGCTGG - Intergenic
1053397413 9:37787140-37787162 CCCGCCCAGCCACCGCCTTCGGG - Intronic
1053479366 9:38404654-38404676 ATCTCCCAGCCCTCTCCCACCGG + Intergenic
1053683283 9:40499260-40499282 CTCCCCCCGTCCCCTCCATCTGG - Intergenic
1054280431 9:63125668-63125690 CTCCCCCCGTCCCCTCCATCTGG + Intergenic
1054296387 9:63334758-63334780 CTCCCCCCGTCCCCTCCATCTGG - Intergenic
1054394404 9:64639263-64639285 CTCCCCCCGTCCCCTCCATCTGG - Intergenic
1054429053 9:65144462-65144484 CTCCCCCCGTCCCCTCCATCTGG - Intergenic
1054501330 9:65877073-65877095 CTCCCCCCGTCCCCTCCATCTGG + Intergenic
1055368359 9:75570366-75570388 CTCTCACATCCCCCACCTCCAGG - Intergenic
1055472741 9:76629753-76629775 CACTCCCAACCCCCAGCTTCTGG + Intronic
1055648173 9:78380417-78380439 CTTTCCCAGCAGCCTCCTTTTGG + Intergenic
1056109798 9:83383744-83383766 TTTTCCCAGCCCCTGCCTTCTGG + Intronic
1056575879 9:87855987-87856009 CTCTCCCAGTCCCTTCCACCGGG - Intergenic
1057047070 9:91894132-91894154 CTCTCCCAGCACCCACCTCTAGG + Intronic
1057117085 9:92535056-92535078 CTCTCCCAGTATCCTCATTCTGG + Intronic
1057876090 9:98755602-98755624 CTCACCCATCCCCCTTCTCCTGG + Intronic
1059247256 9:112859081-112859103 CTCTCCATTCCCCCTCCTGCCGG + Intronic
1060540106 9:124423635-124423657 CTCACACTGTCCCCTCCTTCTGG - Intergenic
1060820408 9:126658433-126658455 GCCTGCCAGCCCCCTCCCTCTGG + Intronic
1061033897 9:128102824-128102846 CTGCCCCAGCCCCCTCCCACCGG - Intronic
1061544531 9:131296850-131296872 CTCTCCCATCCCCTGCCCTCTGG + Intronic
1062082327 9:134630600-134630622 CCCTCCCAGCCCATTCCTCCAGG - Intergenic
1062341686 9:136096240-136096262 TTCTCCCAGCGCCCTCGCTCGGG - Intergenic
1062575906 9:137207627-137207649 CTCCCCCAGTCCTCTCCTTGGGG - Intronic
1203530838 Un_GL000213v1:140394-140416 TCCTCCCAGCCGCCTCTTTCAGG - Intergenic
1185595945 X:1307087-1307109 CTCTCCCACCCACCTCTCTCCGG + Intronic
1186216545 X:7307130-7307152 TCCTCCCAGCCCCTTCCTTTAGG + Intronic
1189848044 X:45154207-45154229 CTCTCTAATCCTCCTCCTTCTGG - Intronic
1190152872 X:47962830-47962852 CTCTCCCAATCCCTTCATTCTGG + Intronic
1191068871 X:56380037-56380059 CTCTGCCCGCCCGCCCCTTCTGG - Intergenic
1191980099 X:66916165-66916187 CTCTCCCAGCTCCCTCCCTGTGG + Intergenic
1192262113 X:69511640-69511662 CTCCCCCAACCCCCACCTTCAGG - Intronic
1194112127 X:89847545-89847567 TTCTCCCACCCTCCACCTTCAGG - Intergenic
1196655213 X:118210904-118210926 TTCTCCTAGCCCCCTTCTCCAGG + Intergenic
1196810403 X:119624595-119624617 CTCTCCCATCCCCCTGCATCAGG - Intronic
1197048658 X:122031283-122031305 CACTCCTACCCTCCTCCTTCTGG + Intergenic
1197722550 X:129755148-129755170 CTCTCCCAGCCCTCACCTCCTGG - Intronic
1198079596 X:133226822-133226844 CTCTCCCTCCCCCAACCTTCCGG + Intergenic
1199527210 X:148805942-148805964 CCCTCTCCGCCCCCTCCTCCTGG - Intronic
1199550164 X:149052179-149052201 CTCTCCCTCCCCCCACCCTCAGG - Intergenic
1199854814 X:151751687-151751709 CTCACACAGCCCCATCCTCCAGG - Intergenic
1199899241 X:152156927-152156949 TTCTCCCACCCACCTCCTTGAGG - Intergenic
1200108871 X:153728926-153728948 CCCTGCCAGCCCCCTCCTCCTGG - Intronic
1200125114 X:153809795-153809817 TCCTCCCTGACCCCTCCTTCTGG - Intronic
1200464782 Y:3502325-3502347 TTCTCCCACCCTCCACCTTCAGG - Intergenic
1201179911 Y:11333688-11333710 TTCTCCCCGCCCCCTCCACCGGG + Intergenic
1201767553 Y:17586778-17586800 CTCTCCCACCCCCAGCCTACAGG + Intergenic
1201834000 Y:18319207-18319229 CTCTCCCACCCCCAGCCTACAGG - Intergenic