ID: 1016990262

View in Genome Browser
Species Human (GRCh38)
Location 6:149923542-149923564
Sequence GAGGCCGCGGGGATGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990262_1016990278 18 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990262_1016990271 1 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990262_1016990276 12 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990262_1016990269 -5 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990262_1016990277 13 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990277 6:149923578-149923600 AGTGGACGTGGTTATAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990262 Original CRISPR GAGGCCGCGGGGATGGGACT GGG (reversed) Intergenic
No off target data available for this crispr