ID: 1016990263

View in Genome Browser
Species Human (GRCh38)
Location 6:149923543-149923565
Sequence TGAGGCCGCGGGGATGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990263_1016990271 0 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990263_1016990280 30 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990280 6:149923596-149923618 CTGGGCTAGGTTTGTTTGTTTGG No data
1016990263_1016990276 11 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990263_1016990269 -6 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990263_1016990277 12 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990277 6:149923578-149923600 AGTGGACGTGGTTATAGCCTGGG No data
1016990263_1016990278 17 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990263 Original CRISPR TGAGGCCGCGGGGATGGGAC TGG (reversed) Intergenic
No off target data available for this crispr