ID: 1016990265

View in Genome Browser
Species Human (GRCh38)
Location 6:149923549-149923571
Sequence TTGGGATGAGGCCGCGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990265_1016990278 11 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990265_1016990276 5 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990265_1016990280 24 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990280 6:149923596-149923618 CTGGGCTAGGTTTGTTTGTTTGG No data
1016990265_1016990281 28 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990265_1016990277 6 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990277 6:149923578-149923600 AGTGGACGTGGTTATAGCCTGGG No data
1016990265_1016990271 -6 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990265 Original CRISPR TTGGGATGAGGCCGCGGGGA TGG (reversed) Intergenic
No off target data available for this crispr