ID: 1016990269

View in Genome Browser
Species Human (GRCh38)
Location 6:149923560-149923582
Sequence GCCTCATCCCAAATCCCGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990260_1016990269 0 Left 1016990260 6:149923537-149923559 CCAAGCCCAGTCCCATCCCCGCG No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990262_1016990269 -5 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990255_1016990269 25 Left 1016990255 6:149923512-149923534 CCAACCCACCGTCCTGTGCGCAG No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990258_1016990269 17 Left 1016990258 6:149923520-149923542 CCGTCCTGTGCGCAGATCCAAGC No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990263_1016990269 -6 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990259_1016990269 13 Left 1016990259 6:149923524-149923546 CCTGTGCGCAGATCCAAGCCCAG No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990256_1016990269 21 Left 1016990256 6:149923516-149923538 CCCACCGTCCTGTGCGCAGATCC No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990254_1016990269 26 Left 1016990254 6:149923511-149923533 CCCAACCCACCGTCCTGTGCGCA No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data
1016990257_1016990269 20 Left 1016990257 6:149923517-149923539 CCACCGTCCTGTGCGCAGATCCA No data
Right 1016990269 6:149923560-149923582 GCCTCATCCCAAATCCCGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990269 Original CRISPR GCCTCATCCCAAATCCCGAG TGG Intergenic
No off target data available for this crispr