ID: 1016990271

View in Genome Browser
Species Human (GRCh38)
Location 6:149923566-149923588
Sequence TCCCAAATCCCGAGTGGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990266_1016990271 -10 Left 1016990266 6:149923553-149923575 CCCCGCGGCCTCATCCCAAATCC No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990259_1016990271 19 Left 1016990259 6:149923524-149923546 CCTGTGCGCAGATCCAAGCCCAG No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990258_1016990271 23 Left 1016990258 6:149923520-149923542 CCGTCCTGTGCGCAGATCCAAGC No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990264_1016990271 -5 Left 1016990264 6:149923548-149923570 CCCATCCCCGCGGCCTCATCCCA No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990263_1016990271 0 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990260_1016990271 6 Left 1016990260 6:149923537-149923559 CCAAGCCCAGTCCCATCCCCGCG No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990265_1016990271 -6 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990256_1016990271 27 Left 1016990256 6:149923516-149923538 CCCACCGTCCTGTGCGCAGATCC No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990257_1016990271 26 Left 1016990257 6:149923517-149923539 CCACCGTCCTGTGCGCAGATCCA No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data
1016990262_1016990271 1 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990271 Original CRISPR TCCCAAATCCCGAGTGGACG TGG Intergenic
No off target data available for this crispr