ID: 1016990272

View in Genome Browser
Species Human (GRCh38)
Location 6:149923567-149923589
Sequence ACCACGTCCACTCGGGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990272_1016990280 6 Left 1016990272 6:149923567-149923589 CCCAAATCCCGAGTGGACGTGGT No data
Right 1016990280 6:149923596-149923618 CTGGGCTAGGTTTGTTTGTTTGG No data
1016990272_1016990278 -7 Left 1016990272 6:149923567-149923589 CCCAAATCCCGAGTGGACGTGGT No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990272_1016990281 10 Left 1016990272 6:149923567-149923589 CCCAAATCCCGAGTGGACGTGGT No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990272_1016990282 14 Left 1016990272 6:149923567-149923589 CCCAAATCCCGAGTGGACGTGGT No data
Right 1016990282 6:149923604-149923626 GGTTTGTTTGTTTGGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990272 Original CRISPR ACCACGTCCACTCGGGATTT GGG (reversed) Intergenic
No off target data available for this crispr