ID: 1016990275

View in Genome Browser
Species Human (GRCh38)
Location 6:149923575-149923597
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990275_1016990282 6 Left 1016990275 6:149923575-149923597 CCGAGTGGACGTGGTTATAGCCT No data
Right 1016990282 6:149923604-149923626 GGTTTGTTTGTTTGGTTGGTTGG No data
1016990275_1016990281 2 Left 1016990275 6:149923575-149923597 CCGAGTGGACGTGGTTATAGCCT No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990275_1016990280 -2 Left 1016990275 6:149923575-149923597 CCGAGTGGACGTGGTTATAGCCT No data
Right 1016990280 6:149923596-149923618 CTGGGCTAGGTTTGTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990275 Original CRISPR AGGCTATAACCACGTCCACT CGG (reversed) Intergenic
No off target data available for this crispr