ID: 1016990276

View in Genome Browser
Species Human (GRCh38)
Location 6:149923577-149923599
Sequence GAGTGGACGTGGTTATAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990267_1016990276 0 Left 1016990267 6:149923554-149923576 CCCGCGGCCTCATCCCAAATCCC No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990263_1016990276 11 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990268_1016990276 -1 Left 1016990268 6:149923555-149923577 CCGCGGCCTCATCCCAAATCCCG No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990266_1016990276 1 Left 1016990266 6:149923553-149923575 CCCCGCGGCCTCATCCCAAATCC No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990265_1016990276 5 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990262_1016990276 12 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990264_1016990276 6 Left 1016990264 6:149923548-149923570 CCCATCCCCGCGGCCTCATCCCA No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990270_1016990276 -7 Left 1016990270 6:149923561-149923583 CCTCATCCCAAATCCCGAGTGGA No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990259_1016990276 30 Left 1016990259 6:149923524-149923546 CCTGTGCGCAGATCCAAGCCCAG No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data
1016990260_1016990276 17 Left 1016990260 6:149923537-149923559 CCAAGCCCAGTCCCATCCCCGCG No data
Right 1016990276 6:149923577-149923599 GAGTGGACGTGGTTATAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990276 Original CRISPR GAGTGGACGTGGTTATAGCC TGG Intergenic
No off target data available for this crispr