ID: 1016990278

View in Genome Browser
Species Human (GRCh38)
Location 6:149923583-149923605
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990267_1016990278 6 Left 1016990267 6:149923554-149923576 CCCGCGGCCTCATCCCAAATCCC No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990270_1016990278 -1 Left 1016990270 6:149923561-149923583 CCTCATCCCAAATCCCGAGTGGA No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990262_1016990278 18 Left 1016990262 6:149923542-149923564 CCCAGTCCCATCCCCGCGGCCTC No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990265_1016990278 11 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990266_1016990278 7 Left 1016990266 6:149923553-149923575 CCCCGCGGCCTCATCCCAAATCC No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990273_1016990278 -8 Left 1016990273 6:149923568-149923590 CCAAATCCCGAGTGGACGTGGTT No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990263_1016990278 17 Left 1016990263 6:149923543-149923565 CCAGTCCCATCCCCGCGGCCTCA No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990264_1016990278 12 Left 1016990264 6:149923548-149923570 CCCATCCCCGCGGCCTCATCCCA No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990268_1016990278 5 Left 1016990268 6:149923555-149923577 CCGCGGCCTCATCCCAAATCCCG No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990260_1016990278 23 Left 1016990260 6:149923537-149923559 CCAAGCCCAGTCCCATCCCCGCG No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data
1016990272_1016990278 -7 Left 1016990272 6:149923567-149923589 CCCAAATCCCGAGTGGACGTGGT No data
Right 1016990278 6:149923583-149923605 ACGTGGTTATAGCCTGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990278 Original CRISPR ACGTGGTTATAGCCTGGGCT AGG Intergenic