ID: 1016990281

View in Genome Browser
Species Human (GRCh38)
Location 6:149923600-149923622
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990264_1016990281 29 Left 1016990264 6:149923548-149923570 CCCATCCCCGCGGCCTCATCCCA No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990273_1016990281 9 Left 1016990273 6:149923568-149923590 CCAAATCCCGAGTGGACGTGGTT No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990267_1016990281 23 Left 1016990267 6:149923554-149923576 CCCGCGGCCTCATCCCAAATCCC No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990265_1016990281 28 Left 1016990265 6:149923549-149923571 CCATCCCCGCGGCCTCATCCCAA No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990272_1016990281 10 Left 1016990272 6:149923567-149923589 CCCAAATCCCGAGTGGACGTGGT No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990274_1016990281 3 Left 1016990274 6:149923574-149923596 CCCGAGTGGACGTGGTTATAGCC No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990270_1016990281 16 Left 1016990270 6:149923561-149923583 CCTCATCCCAAATCCCGAGTGGA No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990266_1016990281 24 Left 1016990266 6:149923553-149923575 CCCCGCGGCCTCATCCCAAATCC No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990268_1016990281 22 Left 1016990268 6:149923555-149923577 CCGCGGCCTCATCCCAAATCCCG No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data
1016990275_1016990281 2 Left 1016990275 6:149923575-149923597 CCGAGTGGACGTGGTTATAGCCT No data
Right 1016990281 6:149923600-149923622 GCTAGGTTTGTTTGTTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990281 Original CRISPR GCTAGGTTTGTTTGTTTGGT TGG Intergenic