ID: 1016990678

View in Genome Browser
Species Human (GRCh38)
Location 6:149925851-149925873
Sequence CCTCGCGGGGACTTTGCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990669_1016990678 13 Left 1016990669 6:149925815-149925837 CCTGGTGGGGTGAGGAGCACGGG No data
Right 1016990678 6:149925851-149925873 CCTCGCGGGGACTTTGCCACCGG No data
1016990663_1016990678 28 Left 1016990663 6:149925800-149925822 CCAGGAAATGCGGGGCCTGGTGG No data
Right 1016990678 6:149925851-149925873 CCTCGCGGGGACTTTGCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990678 Original CRISPR CCTCGCGGGGACTTTGCCAC CGG Intergenic
No off target data available for this crispr