ID: 1016990807

View in Genome Browser
Species Human (GRCh38)
Location 6:149926316-149926338
Sequence CCCTCCACCCTCACTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016990795_1016990807 19 Left 1016990795 6:149926274-149926296 CCGTCTCCTGCTCTCTGCCCAGT No data
Right 1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG No data
1016990793_1016990807 30 Left 1016990793 6:149926263-149926285 CCACCGACTCTCCGTCTCCTGCT No data
Right 1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG No data
1016990799_1016990807 2 Left 1016990799 6:149926291-149926313 CCCAGTAAGGAACACAGGCCCCA No data
Right 1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG No data
1016990800_1016990807 1 Left 1016990800 6:149926292-149926314 CCAGTAAGGAACACAGGCCCCAC No data
Right 1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG No data
1016990797_1016990807 13 Left 1016990797 6:149926280-149926302 CCTGCTCTCTGCCCAGTAAGGAA No data
Right 1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG No data
1016990794_1016990807 27 Left 1016990794 6:149926266-149926288 CCGACTCTCCGTCTCCTGCTCTC No data
Right 1016990807 6:149926316-149926338 CCCTCCACCCTCACTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016990807 Original CRISPR CCCTCCACCCTCACTGTGTT TGG Intergenic
No off target data available for this crispr