ID: 1016993429

View in Genome Browser
Species Human (GRCh38)
Location 6:149944877-149944899
Sequence CTGGTTGAACAGAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 2, 1: 0, 2: 2, 3: 18, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016993429_1016993432 -6 Left 1016993429 6:149944877-149944899 CCATCCTCACTCTGTTCAACCAG 0: 2
1: 0
2: 2
3: 18
4: 261
Right 1016993432 6:149944894-149944916 AACCAGCACCAGCATCCACAGGG 0: 2
1: 0
2: 6
3: 20
4: 244
1016993429_1016993435 -2 Left 1016993429 6:149944877-149944899 CCATCCTCACTCTGTTCAACCAG 0: 2
1: 0
2: 2
3: 18
4: 261
Right 1016993435 6:149944898-149944920 AGCACCAGCATCCACAGGGGTGG 0: 2
1: 0
2: 1
3: 18
4: 228
1016993429_1016993433 -5 Left 1016993429 6:149944877-149944899 CCATCCTCACTCTGTTCAACCAG 0: 2
1: 0
2: 2
3: 18
4: 261
Right 1016993433 6:149944895-149944917 ACCAGCACCAGCATCCACAGGGG 0: 2
1: 0
2: 6
3: 24
4: 305
1016993429_1016993431 -7 Left 1016993429 6:149944877-149944899 CCATCCTCACTCTGTTCAACCAG 0: 2
1: 0
2: 2
3: 18
4: 261
Right 1016993431 6:149944893-149944915 CAACCAGCACCAGCATCCACAGG 0: 2
1: 0
2: 2
3: 43
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016993429 Original CRISPR CTGGTTGAACAGAGTGAGGA TGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900811359 1:4803731-4803753 TGGGTTGAAGAGTGTGAGGAAGG - Intergenic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901713561 1:11135016-11135038 CTGGTTGAACAGGGTGACTTAGG + Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903779777 1:25813923-25813945 CTCGTTGAGCAGGGTGAGGATGG - Exonic
904384255 1:30131321-30131343 CTCCTTGTACAGAGTGGGGAGGG - Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904776586 1:32912164-32912186 CTGGATGAAGGGAGTGATGACGG - Intergenic
904978114 1:34473828-34473850 CTGGTTGATCAAGATGAGGAAGG + Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
910537560 1:88316156-88316178 ATGATTGTACAGAGTGAGCAAGG + Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
915082724 1:153363063-153363085 CTGATTGAACAGGGGGTGGAGGG - Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915347140 1:155203259-155203281 CTGGTTGAAGAGGGTGAGTTGGG + Exonic
915887483 1:159738602-159738624 CATGTTGAATAGACTGAGGAAGG - Intergenic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
918982896 1:191586647-191586669 CTGGATGAACAGAGTTAGTGAGG + Intergenic
919932764 1:202232163-202232185 CTGGTTAAAGTGAGTGAAGAGGG + Intronic
922424523 1:225480835-225480857 CTGAGAGAAAAGAGTGAGGAGGG - Intergenic
922609129 1:226911421-226911443 CAGCTTGAACATAGTGAGGGTGG + Intronic
922972178 1:229751846-229751868 CTGGTTTAACAGCATGATGATGG + Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
924632311 1:245752548-245752570 CTGGAAGAAAAGAGCGAGGAAGG - Intronic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1068008921 10:51423098-51423120 CTGCTTGAACAGGGTGTGAATGG - Intronic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1071392660 10:85190948-85190970 CTGGTAGAAAGGAGTAAGGAAGG + Intergenic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072525578 10:96268615-96268637 CTGGATGAACCCAGTGGGGATGG - Intronic
1072535698 10:96360931-96360953 TTGATTGATCAGAGTGAGGCAGG + Intergenic
1075546857 10:123361728-123361750 CTGGTTGATCAGGGTTGGGAGGG + Intergenic
1076138557 10:128062148-128062170 CTGGTGGAACGGAGTGATGCTGG - Intronic
1076649266 10:131976621-131976643 CTGGTTGCAGAGAGTGTGGTTGG - Intronic
1077119052 11:898460-898482 CTGGTTGCAACGAGCGAGGATGG - Intronic
1078280157 11:9893168-9893190 CTGGCTGGACAGTATGAGGATGG + Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1079684444 11:23339956-23339978 CTGTTTCAAGAGAGAGAGGAAGG - Intergenic
1081828674 11:46085772-46085794 CTGGTTTAACAGAGTTATAATGG + Intronic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083731734 11:64655970-64655992 CTGGCTGGACAGAGAGAGCAGGG + Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088689177 11:112310859-112310881 GGGCTTGAACAGACTGAGGAGGG + Intergenic
1089096431 11:115923521-115923543 CACTTTGAACAGAGTAAGGAGGG + Intergenic
1089430987 11:118424324-118424346 CTATTTGAACAGAGTGTTGAAGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092191944 12:6527684-6527706 TTGCATGAACAAAGTGAGGAAGG - Intronic
1092651688 12:10641784-10641806 CTGGCTGTACAGAATGAGGCAGG - Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1094435288 12:30414306-30414328 CGGGTTGGACAGAGTGACAATGG - Intergenic
1095882073 12:47148433-47148455 CTGTTAGAAGAGAGTGAGTAGGG + Intronic
1098228287 12:68347144-68347166 TTGGTAGAGAAGAGTGAGGAGGG - Intergenic
1099101704 12:78449512-78449534 GTGGCTGAACAGAGTGAGCTAGG + Intergenic
1099646031 12:85358030-85358052 CTGGTTGAATAAACTGAGGCTGG + Intergenic
1100433914 12:94554416-94554438 TTAGTTGAACAGAGTAAGGCAGG + Intergenic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1105819456 13:24066703-24066725 CTTGTTTGAAAGAGTGAGGAGGG - Intronic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106814282 13:33389338-33389360 CTAATTGAACAGTTTGAGGAGGG + Intergenic
1108212751 13:48154872-48154894 CTGGTTGTGCAGAGAGGGGAGGG + Intergenic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1113555795 13:111232973-111232995 CTGGGAGAACAGGGTGGGGATGG + Intronic
1118660633 14:68005920-68005942 CAGGTGGAAGAGAGAGAGGAGGG + Intronic
1118967379 14:70600707-70600729 CGGGTTGAAGAGAGTGCGCATGG + Intergenic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1121978365 14:98428175-98428197 CTGGCTGTATAGAGTAAGGAAGG + Intergenic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1124338306 15:28873612-28873634 ATGGTAGAAGAGACTGAGGAAGG + Intergenic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1125591072 15:40854737-40854759 CTGGATGGAAATAGTGAGGATGG - Intronic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1129848375 15:78778372-78778394 AGGGTTGTACAGAGTGAGGCAGG - Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130765968 15:86871564-86871586 CTTAGTGAACAGAGTGAGGAAGG - Intronic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1135105495 16:19645765-19645787 CTGGGTGACCTGAGTCAGGAGGG + Intronic
1139827930 16:69772268-69772290 TTGGTTGAACTGGGTGGGGAGGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142468197 17:147753-147775 CTGGTGGAAGAGAGACAGGATGG - Intronic
1142728800 17:1836541-1836563 CTGGTTGCCTAGGGTGAGGATGG - Intronic
1143634989 17:8159453-8159475 TTGGGTGAACTGATTGAGGAAGG - Exonic
1146279438 17:31535786-31535808 CAGGTAGAACAGAGTCAGCAGGG + Exonic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1149413978 17:56439007-56439029 ATGGTTGCACAAAGTAAGGAAGG + Intronic
1149761096 17:59230995-59231017 CTCCTTGAAGACAGTGAGGAAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1152558485 17:81066446-81066468 CTCGTTGTCCAGAGTGAGGCAGG + Intronic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1156586865 18:38440717-38440739 CTGGTAGAACTGAGACAGGAAGG - Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1158047878 18:53178093-53178115 CTGATTGAACTGAGTGAAGAAGG - Intronic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162543001 19:11309410-11309432 GTGCTGGAACAGAGTGAGCAAGG - Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1163737462 19:18990260-18990282 CTGCCTGACCAGGGTGAGGAGGG - Intergenic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164011768 19:21209922-21209944 CTGCTTGTGCAGAGTGAGGCTGG + Intergenic
1164451833 19:28372723-28372745 CAGGTTCCACAGGGTGAGGAGGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167487243 19:49769832-49769854 CTGGCTTAACAGGGTGAGAAGGG + Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
1168314470 19:55478451-55478473 CTGGGTGACCAGAGTGACCAGGG + Intronic
926355115 2:12034371-12034393 ATGGATGACCTGAGTGAGGACGG - Intergenic
927436857 2:23073955-23073977 CAGGTTGAACAGAGCAAGGATGG - Intergenic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
928455893 2:31421319-31421341 CTGGTTGAAAAGAAAAAGGACGG - Intergenic
929406789 2:41651599-41651621 CTGGTGGAATAAAGAGAGGACGG - Intergenic
929851598 2:45596258-45596280 CTTGCTGAATAGAATGAGGAGGG - Intronic
930094935 2:47559861-47559883 CTGGTAGAAAACAGGGAGGAAGG + Intronic
930279513 2:49353738-49353760 ATGGTTGCACAGTGTGATGAGGG + Intergenic
930551230 2:52837156-52837178 CTGGCTTCAAAGAGTGAGGAAGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932799189 2:74724330-74724352 CTGGCTGCGTAGAGTGAGGAAGG - Intergenic
935654067 2:105406851-105406873 CAGGCAGAAGAGAGTGAGGAAGG - Intronic
937808641 2:126174910-126174932 CATGTTGAACAGAGAGAGAAGGG - Intergenic
940094254 2:149956199-149956221 CTTCTTCAACAGAGTGATGAGGG + Intergenic
940647083 2:156402968-156402990 CTGGTGGAACTGAGGGAGCAGGG + Intergenic
941221026 2:162781511-162781533 CTAGTGGAAGAGAATGAGGAAGG + Intronic
942697760 2:178665029-178665051 TTGGTGGAACAAAGGGAGGATGG - Intronic
943081608 2:183264166-183264188 CTGTTTCAACACAGTGAGGTAGG - Intergenic
946029491 2:216693420-216693442 CTGGTTTAAGAGATTGGGGAGGG + Intronic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
948520225 2:238531799-238531821 CCGGTTGAACTGTGAGAGGAGGG + Intergenic
1170210283 20:13840737-13840759 ATGGTTGAAGGGAGTGAGGGTGG - Intergenic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1173361265 20:42346650-42346672 CTGGTAGAACTGAGTGTGCAGGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1174442813 20:50569442-50569464 CTATTCCAACAGAGTGAGGAGGG - Intronic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175705774 20:61175371-61175393 AGAGGTGAACAGAGTGAGGATGG - Intergenic
1176112157 20:63415691-63415713 CTGGCAGGACAGTGTGAGGAAGG - Intronic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1180217758 21:46336724-46336746 CTCCGTGGACAGAGTGAGGAAGG + Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1182000771 22:26917873-26917895 CTGGCTGAGCACAGTGGGGATGG + Intergenic
1182042821 22:27251480-27251502 CTTGTGGAACAGAGAGATGAGGG - Intergenic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183771621 22:39931277-39931299 CTGGAAGTACAGAGAGAGGAAGG + Intronic
949268783 3:2190156-2190178 CTAGTGGAACAGACTGAGCAGGG - Intronic
951082089 3:18464587-18464609 CTGTTAGAAGAGAGTGTGGAAGG - Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951709321 3:25573186-25573208 CTGGAAGAACAGAGTGGGCAGGG - Intronic
952577711 3:34794835-34794857 CTAGTTGAACAGACTGCAGAGGG + Intergenic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957188496 3:76974926-76974948 ATCCTTGTACAGAGTGAGGACGG - Intronic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
962944301 3:140153465-140153487 CTGGTGGAGAAGAGTGAGCAGGG - Intronic
963001739 3:140688027-140688049 CTGGTGGACCAGATCGAGGACGG + Exonic
964089873 3:152862790-152862812 TTGGTGGAACAGAGCGAGGTCGG + Intergenic
968192396 3:196678567-196678589 CTACTTGAACCGAGTGATGAAGG + Intronic
968975767 4:3821391-3821413 TGGCTTGAACAGTGTGAGGATGG + Intergenic
970105026 4:12572537-12572559 ATGATTCAACAGAGAGAGGAAGG - Intergenic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG + Intergenic
971642707 4:29156449-29156471 CTGATTGAATAGAAAGAGGATGG + Intergenic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
975397900 4:73898881-73898903 CTGGTTGGACATAGTGGCGATGG - Intergenic
975643433 4:76523762-76523784 CCGGTTGAACAGAGTTTTGAAGG + Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
978911925 4:114074011-114074033 CTGGTTTCACAGAATGAGGTTGG - Intergenic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980162131 4:129177552-129177574 CTGCATGAAGAGATTGAGGATGG + Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
997341030 5:133144735-133144757 CTTGGTCAACACAGTGAGGAGGG + Intergenic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997699066 5:135883653-135883675 GTGGTTGAACAGGGTGATGAGGG + Intronic
997774509 5:136588869-136588891 CTGTTGGAACAGAGTGGGGCAGG + Intergenic
999111438 5:149124976-149124998 CTGATTGAACAGAGTGAGCTGGG + Intergenic
999183842 5:149690736-149690758 CTGGGTGACCTGAGTGAGTAGGG - Intergenic
1001245293 5:170101590-170101612 CTGGTTGATCACAGTCAGGCTGG + Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006883609 6:37360989-37361011 CAGATTGAAAGGAGTGAGGAAGG - Intronic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1007898451 6:45386703-45386725 ATGGTTTAACAAAATGAGGAAGG + Intronic
1012631612 6:101476791-101476813 TTGGTTGAACATAGTGTGCATGG - Intronic
1014403172 6:121015863-121015885 CTTGTTCCACAGAGTGGGGATGG - Intergenic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016989622 6:149920215-149920237 ATGGTGGGACGGAGTGAGGATGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1018180720 6:161221116-161221138 CTGGATGAACATGGTGAGCAAGG + Intronic
1018604238 6:165579979-165580001 GATGTAGAACAGAGTGAGGAGGG - Intronic
1019328741 7:452489-452511 CTGGCTGCCAAGAGTGAGGATGG - Intergenic
1019993723 7:4709787-4709809 CTGGCTGAACAGCGAGAAGACGG - Intronic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021579046 7:22133077-22133099 CTGCCTGAAGGGAGTGAGGAGGG - Intronic
1022081068 7:27021866-27021888 CTAGCTGAAGAGAGAGAGGAGGG + Intergenic
1022532018 7:31072920-31072942 CTGGTTTCAAAGAGGGAGGAAGG + Intronic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024445761 7:49476622-49476644 CTGGTTTCACAGAATGAGTAAGG + Intergenic
1025073600 7:55923276-55923298 CTAGTTGCACTGGGTGAGGATGG + Exonic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032334316 7:131010880-131010902 CTGGTTGAAGAAACTAAGGAAGG - Intergenic
1034140676 7:148812661-148812683 CTTTCTGAACAAAGTGAGGAAGG + Intronic
1035583374 8:754050-754072 CTGGCAGATCTGAGTGAGGATGG + Intergenic
1037522486 8:19693360-19693382 CTGGTAGAACAGAGAGAGGATGG - Intronic
1038015196 8:23508937-23508959 CTGGTTGATTAGAGAGAGGGCGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038517258 8:28197558-28197580 CTAGTTGAACAGACTGAGCTGGG - Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039379834 8:37074716-37074738 ATGATTGAGCAGAGAGAGGAAGG - Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1040435043 8:47381913-47381935 CTGGTAGAACAAAGGGAGGATGG - Intronic
1042089253 8:65140822-65140844 CCGCTGGAACAGAGTGAGAACGG + Intergenic
1045475591 8:102549757-102549779 TTTAGTGAACAGAGTGAGGATGG - Intergenic
1045689617 8:104746812-104746834 CTGGCTTAACAGAGGGAGGTAGG + Intronic
1048657154 8:136553141-136553163 ATGGATGAAGAAAGTGAGGAAGG - Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053450714 9:38192094-38192116 CTGGATGAAGAGAGTGAGTGTGG + Intergenic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054821913 9:69531327-69531349 TTTGTTGAACAGGGTGATGAAGG - Intronic
1055136522 9:72835274-72835296 TGGGATGAACAGAGTGAAGATGG - Intronic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1057592619 9:96385374-96385396 CTGTTTAAACAGGGTAAGGATGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1059383260 9:113945100-113945122 CTGGCAGGACAGAGTGAGGTAGG - Intronic
1061366995 9:130177307-130177329 CTGGTTGAGCAGAGTTGGGTGGG - Intronic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1062118133 9:134820149-134820171 CCGGGTGAACAGGGTGAGAAGGG + Exonic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1185583537 X:1228386-1228408 ATGGTTGAACAGAGAGGTGAAGG - Intergenic
1187699085 X:21947507-21947529 CTGGTTGGGCTGAGTGAGGTAGG - Intronic
1188816151 X:34716990-34717012 CTGATTGAACCCAGTGAGGGAGG + Intergenic
1189383564 X:40518858-40518880 CTGGTGGAATAGGGTGGGGAGGG + Intergenic
1190323380 X:49191535-49191557 CTGGTTGACCATAGTCAGGCTGG + Exonic
1190894234 X:54600562-54600584 CTGGTTGAAGTGGGTGGGGATGG + Intergenic
1192754474 X:74032649-74032671 ATGATTGAACTTAGTGAGGAAGG + Intergenic
1194442744 X:93953294-93953316 CTGGTTTAATAGAGTGAGTTAGG + Intergenic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1198077980 X:133212769-133212791 CTGGGTGACAAGAGTGAGGCGGG + Intergenic
1199663074 X:150072063-150072085 CTGATACAACAGAGTGAGAAAGG - Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic