ID: 1016996200

View in Genome Browser
Species Human (GRCh38)
Location 6:149963908-149963930
Sequence CCTAGGCATGCACTTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016996200_1016996207 5 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996207 6:149963936-149963958 GCCCAGTGTATCCCTGCGCGCGG 0: 1
1: 0
2: 0
3: 3
4: 48
1016996200_1016996213 14 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996213 6:149963945-149963967 ATCCCTGCGCGCGGCGGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 95
1016996200_1016996210 8 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996210 6:149963939-149963961 CAGTGTATCCCTGCGCGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 49
1016996200_1016996212 13 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996212 6:149963944-149963966 TATCCCTGCGCGCGGCGGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 51
1016996200_1016996216 18 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996216 6:149963949-149963971 CTGCGCGCGGCGGGCCGGGCTGG 0: 1
1: 0
2: 10
3: 81
4: 681
1016996200_1016996217 19 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996217 6:149963950-149963972 TGCGCGCGGCGGGCCGGGCTGGG 0: 1
1: 0
2: 5
3: 51
4: 384
1016996200_1016996211 9 Left 1016996200 6:149963908-149963930 CCCCAAAAAAGTGCATGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1016996211 6:149963940-149963962 AGTGTATCCCTGCGCGCGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016996200 Original CRISPR CCTAGGCATGCACTTTTTTG GGG (reversed) Intergenic
901193506 1:7426403-7426425 CCCAGGTAGGCAGTTTTTTGGGG - Intronic
903243025 1:21996535-21996557 CATAGACATGCCCTTTTTTATGG - Intronic
906023511 1:42652903-42652925 CCTGGGTATGGGCTTTTTTGGGG + Intronic
906320485 1:44812695-44812717 CCTAGGCTTGATTTTTTTTGAGG - Intronic
906803076 1:48754536-48754558 CCTCGGCATTTACTTATTTGGGG + Intronic
909052070 1:70778108-70778130 CCTAGGCCTGTACTTGATTGAGG - Intergenic
909344572 1:74571116-74571138 CCTAGACCTGCACGTTGTTGGGG + Exonic
910010145 1:82451625-82451647 CCCAGCCATGCAGTTTTCTGAGG + Intergenic
910633968 1:89386616-89386638 CTAAGGCATACACTTTTCTGTGG + Intergenic
916272759 1:162961562-162961584 CCTTGGCATGTCCTTTTTTATGG - Intergenic
916941024 1:169677966-169677988 CCTTGGCAAGTAATTTTTTGGGG + Intronic
919568076 1:199214335-199214357 CCTAGATATGCAAATTTTTGTGG + Intergenic
919757838 1:201077000-201077022 CCTGGGCATGCAGCTCTTTGGGG - Exonic
921506372 1:215976050-215976072 CCTAGGAATTTACTGTTTTGTGG + Intronic
921983296 1:221282209-221282231 CCTAGGTATTTAATTTTTTGTGG + Intergenic
924310042 1:242731646-242731668 CCTAGACTTCCACTCTTTTGAGG + Intergenic
1068875761 10:61994930-61994952 AATAGGCATTCACTTTTTTTTGG + Intronic
1071113997 10:82195461-82195483 CCCAGGGATGAACTTTGTTGTGG + Intronic
1074962925 10:118464084-118464106 CCTAGGCAGGCAGATTTGTGAGG - Intergenic
1075725021 10:124606663-124606685 CTGGGCCATGCACTTTTTTGGGG + Intronic
1076882742 10:133247569-133247591 CCTATGCATATACTTCTTTGAGG - Intergenic
1079706728 11:23630719-23630741 TCTATGCATTTACTTTTTTGTGG + Intergenic
1080607773 11:33877834-33877856 CCTAGGAATGCCCATTGTTGAGG + Intronic
1082281366 11:50274464-50274486 CCTGTGCATGCATTTGTTTGGGG + Intergenic
1082914836 11:58421978-58422000 CATAAACATGTACTTTTTTGTGG + Intergenic
1085683384 11:78599145-78599167 CCTAGGAATACACCTTTTAGGGG - Intergenic
1088650208 11:111951276-111951298 TCTGGGCCTGTACTTTTTTGAGG - Intronic
1091011614 11:132006595-132006617 CCTAGGCACACACTGCTTTGTGG - Intronic
1092249275 12:6883594-6883616 GCTAGGCATGCATTTTTCTTGGG + Intronic
1095811436 12:46376204-46376226 CCTAGTGATGCACTTCTATGTGG + Intergenic
1097309080 12:58099021-58099043 ATTAGGCATGGACATTTTTGGGG + Intergenic
1099195514 12:79610083-79610105 CCTAGCCAGGCACTTTGGTGTGG - Intronic
1100791907 12:98139556-98139578 CCAAGTCATTCACTTTTCTGAGG - Intergenic
1103788649 12:123453424-123453446 CCTAGGCATGCTCTACTTTCTGG + Intergenic
1105225142 13:18424986-18425008 CCTAGGCATCCTCTTTTCGGAGG + Intergenic
1105359835 13:19699721-19699743 TTTAGGCATGGACTTTTTGGGGG - Intronic
1107281542 13:38741767-38741789 TCTAGGCATGCATTTTTATGAGG + Intronic
1107640958 13:42442810-42442832 ACTTGGCCTGCACTTCTTTGAGG - Intergenic
1107884185 13:44860771-44860793 CCTAGACATGCGCTTTCTTTAGG - Intergenic
1108447830 13:50527021-50527043 TTTGGGCATGCACTTCTTTGGGG + Intronic
1112536574 13:100263006-100263028 CTTAGGAATGCATTTTTTGGAGG - Intronic
1114009251 14:18349354-18349376 CCTAGGCATCCTCTTTTCGGAGG + Intergenic
1118193364 14:63601428-63601450 ACTAGGCATGCATGTTTTTCTGG - Intronic
1118622630 14:67627834-67627856 CCTAGGCAAAGACTTTTTTGTGG - Intronic
1120732373 14:88018069-88018091 CTTATGCATGCACTTTACTGTGG + Intergenic
1121445487 14:93975983-93976005 CCTAGGCATGCACGGTATTGTGG - Intronic
1121838017 14:97109323-97109345 GCTAGGCATGCACCATCTTGAGG + Intergenic
1122413843 14:101539254-101539276 CCTGGGGATGCACTTGGTTGGGG - Intergenic
1123392442 15:19889957-19889979 CCTAGGCATCCTCTTTTCGGAGG + Intergenic
1124583599 15:30985098-30985120 CCAGGGCATGCTCTTTTTTAAGG - Intronic
1125209741 15:37199567-37199589 CCTATGCATGAACTTTGTTTAGG - Intergenic
1135574312 16:23573585-23573607 GCTAAGGATGCACTTTCTTGTGG + Exonic
1135869190 16:26133641-26133663 TCTCGGCAAGCACTTTTATGAGG - Intronic
1136005628 16:27326964-27326986 GCTAGGCATGCACTTCTTCCTGG - Intronic
1138204441 16:55114548-55114570 CCTTGGCATTCACTTTTTGGAGG + Intergenic
1138298019 16:55903290-55903312 GCTAGGCATGTCCTTTTATGAGG - Intronic
1138452820 16:57103889-57103911 CCTAGGAAAGCACTCTTTTTTGG + Intronic
1140880007 16:79189599-79189621 CCTAGGAAAGCATATTTTTGAGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1143558427 17:7676824-7676846 ACCAGCCATGCACTTCTTTGAGG + Intronic
1147479697 17:40748190-40748212 CTTAGACATGCACATTTTTCTGG + Exonic
1148098743 17:45073926-45073948 CCCAGGCATGCAGTTTTGAGCGG + Intronic
1152063527 17:78096964-78096986 CCTAGGACTGTAGTTTTTTGAGG - Intronic
1153103373 18:1499858-1499880 CCTATCCATTCACTTTTATGAGG + Intergenic
1154528224 18:15314536-15314558 CCTAGGCATCCTCTTTTCGGAGG - Intergenic
1154958437 18:21283174-21283196 CCTATGCATGGAATTTTCTGAGG - Intronic
1155799805 18:30087273-30087295 CTTCTGCATGCACTTTTCTGAGG + Intergenic
1156537386 18:37877412-37877434 CCTTGGCATGAACTGTTTAGAGG + Intergenic
1157208311 18:45719308-45719330 CCTTGCCATGCTCTTTGTTGAGG - Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1159868629 18:73735520-73735542 CCCAGGCATGCTCTTTTTTCAGG - Intergenic
1164937156 19:32223851-32223873 CCTAGGCAGGAACTTTCTTCTGG - Intergenic
1165075801 19:33279223-33279245 CCTAGGCAGTCACTTTCTGGGGG + Intergenic
1167882569 19:52472632-52472654 CCATGGCATGCTCTATTTTGAGG + Intronic
927629188 2:24756382-24756404 CCTAGGCATATAATTTTCTGTGG + Intronic
927852069 2:26505719-26505741 CGTAGGACTGCACTTTTCTGTGG + Intronic
929983694 2:46704843-46704865 CCTAGGTAAGCACTGTTTGGAGG + Intronic
930710866 2:54549991-54550013 CCTGGTCATGCACTTGTTTGAGG + Intronic
931353333 2:61512000-61512022 CCTAGGCAGGCAATTGTCTGAGG - Intronic
933201253 2:79452173-79452195 GCTACGCATTCACTTCTTTGGGG - Intronic
933505333 2:83170145-83170167 CCTGAGCATTCACTTTTTTATGG - Intergenic
938739879 2:134221000-134221022 CCTTGTCCTGCAGTTTTTTGTGG + Intronic
941367547 2:164625472-164625494 CATAGGCATGCACTTCTGGGAGG + Intergenic
943675204 2:190710424-190710446 CCTAGGCCAGCATTTTTTTCAGG + Intergenic
947326285 2:228981786-228981808 CCTAGGCATTCACTTTATTAGGG + Intronic
1169566478 20:6858706-6858728 CTTCGGCATGAAATTTTTTGGGG + Intergenic
1172562427 20:35901123-35901145 CCTAAGCATGCTTTTTATTGAGG - Intronic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1172923243 20:38505740-38505762 GCAAGGCATGCACGTTTTTTTGG - Intronic
1173403656 20:42746427-42746449 CATAGGCACGCACTTTGTTTAGG + Intronic
1175378173 20:58543628-58543650 CTTAGGCATGAACCTTTCTGGGG - Intergenic
1175467435 20:59198940-59198962 TCTAGGCATGGACGTCTTTGAGG + Intronic
1176769194 21:13054004-13054026 CCTAGGCATCCTCTTTTCGGAGG + Intergenic
1180234907 21:46452530-46452552 CCTGGTCGTCCACTTTTTTGTGG - Intergenic
1180433752 22:15280164-15280186 CCTAGGCATCCTCTTTTTGGAGG + Intergenic
1183530896 22:38352728-38352750 CCTGGGCCTGGACTTTTCTGTGG + Intronic
951230170 3:20169370-20169392 CCTTGGTATTCTCTTTTTTGAGG - Intronic
953580238 3:44147241-44147263 CCTGAGCATGGACTTTGTTGGGG - Intergenic
955653953 3:61224047-61224069 CCTTGACATCCACGTTTTTGGGG - Intronic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
956943474 3:74192516-74192538 TCTAGGCATGTAATTTTTAGGGG + Intergenic
964449810 3:156801135-156801157 CCGAGGCAGGCACCTCTTTGAGG + Intergenic
970066706 4:12103269-12103291 CCTATGCATGCACAATCTTGTGG - Intergenic
970449139 4:16149715-16149737 CATAGGAATGCAATTTATTGTGG + Intergenic
970918263 4:21361988-21362010 GTTAGGCAGGCACTTCTTTGGGG - Intronic
971453167 4:26819028-26819050 CCCTGGCATCCACTTCTTTGGGG - Intergenic
971926801 4:33021876-33021898 CCTAGGCATTCATTTCTTTTGGG - Intergenic
976151191 4:82093664-82093686 ACTTTGCATGCAGTTTTTTGGGG - Intergenic
977081186 4:92530482-92530504 ACTAGTCACTCACTTTTTTGTGG - Intronic
980845204 4:138316026-138316048 ACTAGGCATGAACTTTTGGGTGG - Intergenic
984835548 4:184016592-184016614 CTTGAGCATGCCCTTTTTTGGGG - Intronic
985288715 4:188363880-188363902 CCTAGGCAATCATCTTTTTGTGG - Intergenic
986622735 5:9692418-9692440 CATAGGAATGGACTTTGTTGGGG - Intronic
986650330 5:9957251-9957273 CAGAGACATCCACTTTTTTGTGG + Intergenic
990669148 5:58107780-58107802 CCTAGGCATACAATTTGCTGAGG + Intergenic
992236367 5:74713608-74713630 CCTGGGCATACACTATCTTGGGG + Exonic
993823294 5:92647726-92647748 CCAATGCATGGACTTTCTTGAGG - Intergenic
996533605 5:124552405-124552427 CACAGGCATGCACTTTGTTCAGG - Intergenic
1000180014 5:158799773-158799795 GCTAGGCCTGCATTTTTATGGGG - Intronic
1000305304 5:159989024-159989046 CCTAGAAATGGATTTTTTTGAGG + Intergenic
1001076149 5:168629461-168629483 TCTATGCATTCACTTTGTTGTGG - Intergenic
1004560403 6:16744187-16744209 CCTAGGGATTGAATTTTTTGAGG - Intronic
1007336297 6:41157354-41157376 CCTGGGCATCCACTTCTCTGGGG + Intergenic
1007754440 6:44089868-44089890 CCAAGTCATGCGCTCTTTTGGGG + Intergenic
1008434855 6:51464090-51464112 CCCATGCATGCTCTTTTATGAGG + Intergenic
1009351015 6:62678622-62678644 CATAGGCAAGCACGTCTTTGAGG - Intergenic
1009993917 6:70878053-70878075 CCTATACAAGCACTTTTTTAAGG + Intronic
1011092897 6:83626593-83626615 CCTAGGTTTTCAATTTTTTGTGG + Intronic
1014639059 6:123886107-123886129 CAAAGGCATGCACTTTAGTGAGG + Intronic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1019787030 7:2983602-2983624 CCTAGGCCTGAACTGCTTTGGGG - Intronic
1021880576 7:25091804-25091826 CATAGGCATGGACTTTTTCCTGG + Intergenic
1022314293 7:29230221-29230243 ACTAGGCAAACACTTTTCTGAGG - Intronic
1024508004 7:50179405-50179427 CCTGGTCATGCCTTTTTTTGGGG - Intergenic
1024997769 7:55286914-55286936 CCTTGGCAGACACTTGTTTGAGG + Intergenic
1026595701 7:71732662-71732684 CCTAGGCCTGCAGCTCTTTGAGG - Intergenic
1028018608 7:85744288-85744310 CCTAGGCATCCTCTTTTCAGGGG - Intergenic
1031724351 7:125218694-125218716 CCTAGGTATTTAATTTTTTGTGG - Intergenic
1035708226 8:1693973-1693995 CCTAGGCAGGCACTGTCTTTAGG + Intronic
1039524417 8:38201229-38201251 TCTAGACATACACCTTTTTGAGG + Intronic
1043175557 8:77019827-77019849 CCTAGGCATTTGCTTTTTGGAGG + Intergenic
1046137160 8:110042675-110042697 CCTAGGTATCCTATTTTTTGTGG + Intergenic
1046245254 8:111551329-111551351 CCGAGGCAGGCACTTTTGGGAGG - Intergenic
1050283365 9:4075714-4075736 CCTATGCATACACTTCTTGGTGG - Intronic
1052143220 9:25014868-25014890 CCTACGCATCCATTTTTTTATGG - Intergenic
1053466619 9:38313164-38313186 CCTGGGCATTCAGTTTTGTGAGG - Intergenic
1054859202 9:69932064-69932086 CCTAGGCATCCTCTTTTCGGGGG - Intergenic
1055281915 9:74683905-74683927 ACTAGGCATGCAATTCCTTGTGG + Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058327119 9:103712435-103712457 CCTAGGCATTGTATTTTTTGTGG + Intergenic
1059253027 9:112904321-112904343 CCCAGGCCTAGACTTTTTTGGGG + Intergenic
1186190845 X:7066291-7066313 ACGAGGCATGGATTTTTTTGAGG + Intronic
1189807517 X:44750422-44750444 CTTTGGCATACAGTTTTTTGGGG + Intergenic
1191989105 X:67013395-67013417 CCTAGGAATGCTATATTTTGTGG - Intergenic
1192990429 X:76448209-76448231 CATACTCATCCACTTTTTTGTGG + Intergenic
1194520381 X:94910863-94910885 CCTAGGCATTTTATTTTTTGTGG - Intergenic
1195686437 X:107591013-107591035 CCTGGGCCTGGACTTTTTTCGGG + Intronic
1196533046 X:116812375-116812397 CCTGGGCATTCACATATTTGTGG + Intergenic
1196812290 X:119638290-119638312 CCTTTGCTTGCACTCTTTTGAGG - Intronic
1196933576 X:120706251-120706273 CCTAGGTATTTACATTTTTGTGG - Intergenic
1199856370 X:151762133-151762155 GCTAAGTAAGCACTTTTTTGAGG + Intergenic
1202042130 Y:20696896-20696918 CCTGGTGATGCACTTGTTTGTGG + Intergenic