ID: 1017000190

View in Genome Browser
Species Human (GRCh38)
Location 6:149991081-149991103
Sequence CGCGCCCAGCACCAGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000190_1017000200 25 Left 1017000190 6:149991081-149991103 CCTACAGCCTGGTGCTGGGCGCG No data
Right 1017000200 6:149991129-149991151 CCGAGACGTGACCTTACAGCTGG No data
1017000190_1017000202 27 Left 1017000190 6:149991081-149991103 CCTACAGCCTGGTGCTGGGCGCG No data
Right 1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG No data
1017000190_1017000201 26 Left 1017000190 6:149991081-149991103 CCTACAGCCTGGTGCTGGGCGCG No data
Right 1017000201 6:149991130-149991152 CGAGACGTGACCTTACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000190 Original CRISPR CGCGCCCAGCACCAGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr