ID: 1017000195

View in Genome Browser
Species Human (GRCh38)
Location 6:149991088-149991110
Sequence TCCTCCCCGCGCCCAGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000195_1017000202 20 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG No data
1017000195_1017000200 18 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000200 6:149991129-149991151 CCGAGACGTGACCTTACAGCTGG No data
1017000195_1017000203 27 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000203 6:149991138-149991160 GACCTTACAGCTGGGGTCCTTGG No data
1017000195_1017000206 29 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000206 6:149991140-149991162 CCTTACAGCTGGGGTCCTTGGGG No data
1017000195_1017000201 19 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000201 6:149991130-149991152 CGAGACGTGACCTTACAGCTGGG No data
1017000195_1017000204 28 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000204 6:149991139-149991161 ACCTTACAGCTGGGGTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000195 Original CRISPR TCCTCCCCGCGCCCAGCACC AGG (reversed) Intergenic