ID: 1017000200

View in Genome Browser
Species Human (GRCh38)
Location 6:149991129-149991151
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000190_1017000200 25 Left 1017000190 6:149991081-149991103 CCTACAGCCTGGTGCTGGGCGCG No data
Right 1017000200 6:149991129-149991151 CCGAGACGTGACCTTACAGCTGG No data
1017000189_1017000200 28 Left 1017000189 6:149991078-149991100 CCTCCTACAGCCTGGTGCTGGGC No data
Right 1017000200 6:149991129-149991151 CCGAGACGTGACCTTACAGCTGG No data
1017000195_1017000200 18 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000200 6:149991129-149991151 CCGAGACGTGACCTTACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000200 Original CRISPR CCGAGACGTGACCTTACAGC TGG Intergenic