ID: 1017000202

View in Genome Browser
Species Human (GRCh38)
Location 6:149991131-149991153
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000196_1017000202 -10 Left 1017000196 6:149991118-149991140 CCCAGCTCCTGCCGAGACGTGAC No data
Right 1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG No data
1017000189_1017000202 30 Left 1017000189 6:149991078-149991100 CCTCCTACAGCCTGGTGCTGGGC No data
Right 1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG No data
1017000195_1017000202 20 Left 1017000195 6:149991088-149991110 CCTGGTGCTGGGCGCGGGGAGGA No data
Right 1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG No data
1017000190_1017000202 27 Left 1017000190 6:149991081-149991103 CCTACAGCCTGGTGCTGGGCGCG No data
Right 1017000202 6:149991131-149991153 GAGACGTGACCTTACAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000202 Original CRISPR GAGACGTGACCTTACAGCTG GGG Intergenic