ID: 1017000523

View in Genome Browser
Species Human (GRCh38)
Location 6:149993968-149993990
Sequence TTCAACAGAAATGAGTAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000523_1017000527 -6 Left 1017000523 6:149993968-149993990 CCCCATTACTCATTTCTGTTGAA No data
Right 1017000527 6:149993985-149994007 GTTGAAGATTAGATGGCTTTAGG No data
1017000523_1017000528 2 Left 1017000523 6:149993968-149993990 CCCCATTACTCATTTCTGTTGAA No data
Right 1017000528 6:149993993-149994015 TTAGATGGCTTTAGGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000523 Original CRISPR TTCAACAGAAATGAGTAATG GGG (reversed) Intergenic