ID: 1017000528

View in Genome Browser
Species Human (GRCh38)
Location 6:149993993-149994015
Sequence TTAGATGGCTTTAGGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000525_1017000528 0 Left 1017000525 6:149993970-149993992 CCATTACTCATTTCTGTTGAAGA No data
Right 1017000528 6:149993993-149994015 TTAGATGGCTTTAGGTGTGCAGG No data
1017000524_1017000528 1 Left 1017000524 6:149993969-149993991 CCCATTACTCATTTCTGTTGAAG No data
Right 1017000528 6:149993993-149994015 TTAGATGGCTTTAGGTGTGCAGG No data
1017000523_1017000528 2 Left 1017000523 6:149993968-149993990 CCCCATTACTCATTTCTGTTGAA No data
Right 1017000528 6:149993993-149994015 TTAGATGGCTTTAGGTGTGCAGG No data
1017000522_1017000528 3 Left 1017000522 6:149993967-149993989 CCCCCATTACTCATTTCTGTTGA No data
Right 1017000528 6:149993993-149994015 TTAGATGGCTTTAGGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000528 Original CRISPR TTAGATGGCTTTAGGTGTGC AGG Intergenic
No off target data available for this crispr