ID: 1017000773

View in Genome Browser
Species Human (GRCh38)
Location 6:149995782-149995804
Sequence CTGTGACTGTGCAGGGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017000773_1017000786 27 Left 1017000773 6:149995782-149995804 CCTATGTCCCTGCACAGTCACAG No data
Right 1017000786 6:149995832-149995854 CGGAAGCAGAGACAGGCCCTGGG No data
1017000773_1017000777 7 Left 1017000773 6:149995782-149995804 CCTATGTCCCTGCACAGTCACAG No data
Right 1017000777 6:149995812-149995834 TGCCATCCTATGCCCCTGTCCGG No data
1017000773_1017000782 20 Left 1017000773 6:149995782-149995804 CCTATGTCCCTGCACAGTCACAG No data
Right 1017000782 6:149995825-149995847 CCCTGTCCGGAAGCAGAGACAGG No data
1017000773_1017000785 26 Left 1017000773 6:149995782-149995804 CCTATGTCCCTGCACAGTCACAG No data
Right 1017000785 6:149995831-149995853 CCGGAAGCAGAGACAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017000773 Original CRISPR CTGTGACTGTGCAGGGACAT AGG (reversed) Intergenic
No off target data available for this crispr